ID: 1178804464

View in Genome Browser
Species Human (GRCh38)
Location 21:35826836-35826858
Sequence GAGTTTGGCATCACAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178804464_1178804467 3 Left 1178804464 21:35826836-35826858 CCATGCTCTGTGATGCCAAACTC 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1178804467 21:35826862-35826884 TATAAAACATTTACTGGAGAAGG 0: 1
1: 0
2: 4
3: 39
4: 557
1178804464_1178804470 15 Left 1178804464 21:35826836-35826858 CCATGCTCTGTGATGCCAAACTC 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1178804470 21:35826874-35826896 ACTGGAGAAGGGTATCAAACGGG 0: 1
1: 0
2: 0
3: 9
4: 154
1178804464_1178804469 14 Left 1178804464 21:35826836-35826858 CCATGCTCTGTGATGCCAAACTC 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1178804469 21:35826873-35826895 TACTGGAGAAGGGTATCAAACGG 0: 1
1: 0
2: 0
3: 13
4: 141
1178804464_1178804468 4 Left 1178804464 21:35826836-35826858 CCATGCTCTGTGATGCCAAACTC 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1178804468 21:35826863-35826885 ATAAAACATTTACTGGAGAAGGG 0: 1
1: 0
2: 4
3: 30
4: 490
1178804464_1178804466 -3 Left 1178804464 21:35826836-35826858 CCATGCTCTGTGATGCCAAACTC 0: 1
1: 0
2: 0
3: 23
4: 185
Right 1178804466 21:35826856-35826878 CTCTATTATAAAACATTTACTGG 0: 1
1: 1
2: 2
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178804464 Original CRISPR GAGTTTGGCATCACAGAGCA TGG (reversed) Intronic
900525832 1:3128182-3128204 GGGTCTGTCATCACAGGGCATGG - Intronic
903190893 1:21655444-21655466 GTGTTTGACATCACACAGCTAGG - Intronic
903224132 1:21885310-21885332 GAGTTTGGCTGCAGTGAGCAGGG - Exonic
903302654 1:22390341-22390363 CAGTTCCGCCTCACAGAGCAGGG - Intergenic
903583210 1:24387778-24387800 AAGTCAGGCTTCACAGAGCAGGG + Intronic
903768117 1:25747632-25747654 CAGCTTGCCAGCACAGAGCAGGG + Intronic
904290864 1:29485231-29485253 GAGGTTGGGAGCAGAGAGCAGGG - Intergenic
905321835 1:37123164-37123186 GAATTTGGTGTTACAGAGCATGG - Intergenic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
911424928 1:97696280-97696302 GAGTTTACCATCTCAGAGGATGG - Intronic
913570598 1:120116052-120116074 CAGCTTGGGATCACTGAGCATGG - Intergenic
914291405 1:146277031-146277053 CAGCTTGGGATCACTGAGCATGG - Intergenic
914552449 1:148727814-148727836 CAGCTTGGGATCACTGAGCATGG - Intergenic
915703420 1:157819982-157820004 GAGTTGGGCAACTCAGAGCAGGG - Intronic
916662568 1:166935914-166935936 GCTTTTGAAATCACAGAGCAAGG - Intronic
918577396 1:186079407-186079429 CAGTTTGGCATGGCATAGCATGG - Intronic
918605983 1:186426460-186426482 GAGTTTGGCTTCCCACAGCATGG + Intergenic
918855076 1:189742392-189742414 GAATTTGGCAACACAGAGATTGG + Intergenic
918994376 1:191737854-191737876 GATTTTGGAATCACATACCAGGG - Intergenic
919090359 1:192971448-192971470 GAATTTGACATCAGAGAGTATGG + Intergenic
919814157 1:201427264-201427286 GACTTTGGCACCAGAGAGCTGGG - Intronic
920950215 1:210565608-210565630 GAGTTTGGAATCACAAAGAATGG + Intronic
920980493 1:210829803-210829825 GAGTTGGGGATCATAGAGCTTGG - Intronic
923057843 1:230441047-230441069 GCTCTTGGCATCATAGAGCAGGG + Intergenic
924012170 1:239677101-239677123 GAGGGTGACATCACAGAGCAGGG - Intronic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1063463988 10:6231644-6231666 GGCTGTGGGATCACAGAGCAGGG - Intronic
1063498759 10:6534246-6534268 GCATTTGGAATCACAGAGAAGGG - Intronic
1063899705 10:10719691-10719713 GAGGTTAGGGTCACAGAGCAAGG - Intergenic
1064949251 10:20829161-20829183 GATTTTGGAATCAGAGAGCCTGG - Intronic
1066455721 10:35569653-35569675 GATTTTGGTCCCACAGAGCAGGG + Exonic
1068936700 10:62642811-62642833 AAGTCTGACATCACAGAGAATGG - Intronic
1075317128 10:121461702-121461724 GAGTTTTGCATCTCAGACTATGG - Intergenic
1076142516 10:128091097-128091119 GAATGTGGCGTCACAGTGCAGGG + Intergenic
1077539529 11:3139986-3140008 GAGGCTGGCTTCTCAGAGCAGGG - Intronic
1077957431 11:7035819-7035841 GGGTCTGCTATCACAGAGCATGG + Intronic
1078019965 11:7648668-7648690 CAGGTTGGCATCCCAGGGCACGG + Intronic
1078431892 11:11294470-11294492 GAGGTTGGCATCTAAGAGCCTGG - Intronic
1078607713 11:12791629-12791651 AAGTTAGGCATCAGAGAGCATGG + Intronic
1079544035 11:21611277-21611299 GAGTTTGGCATCAGACAGTAAGG - Intergenic
1081099313 11:38982545-38982567 CAGCTTGGCCTCACAGGGCAGGG - Intergenic
1084656612 11:70523392-70523414 GAGTTTGTGACCTCAGAGCAGGG + Intronic
1085069495 11:73530275-73530297 TAGTCTCGTATCACAGAGCAAGG - Intronic
1085131401 11:74042101-74042123 CAGTTTGTCATCACATGGCAAGG + Exonic
1085701703 11:78751792-78751814 GGGTTTGGGATCAGAGAGCTGGG - Intronic
1088437795 11:109834496-109834518 GAGTTTTGGATCACAGAGGCCGG - Intergenic
1091186105 11:133649394-133649416 GAGGTTGGCATCCCAGGGCGGGG - Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1092012722 12:5128390-5128412 GAGTGTGGCATCACAGTGGAAGG - Intergenic
1097160478 12:57043181-57043203 TAGGGTGGCATCACAGAACAGGG + Intronic
1098037580 12:66321097-66321119 AAGTTTGTCTTCCCAGAGCAGGG + Intronic
1101508880 12:105375020-105375042 GAGTTTGCCAGCATAGATCAAGG + Intronic
1103285922 12:119801697-119801719 GCCATTGGCATCAAAGAGCAGGG - Intronic
1104245075 12:127031902-127031924 GAGCTTGGCTTCACATAGGAGGG - Intergenic
1109372179 13:61437197-61437219 TAGTTTTGCAACTCAGAGCAAGG + Intergenic
1109507699 13:63328261-63328283 GACTTGAGCATCACATAGCATGG - Intergenic
1110524019 13:76514780-76514802 TAGGTTTGCATGACAGAGCACGG + Intergenic
1112826144 13:103394254-103394276 GTGTTTTACATCACAGAGAATGG - Intergenic
1114912961 14:27223449-27223471 GTGTGTGGCATGACAGGGCAGGG - Intergenic
1119277638 14:73373674-73373696 GAGTTAGGCCTCACTGAGAAAGG + Intronic
1120187299 14:81406883-81406905 GAGTTGGGGAGCAGAGAGCATGG - Intronic
1120728586 14:87976381-87976403 GAGTTCGGCATCAAGGAGCATGG + Exonic
1121915068 14:97831326-97831348 GAGGTTGGAATAACAGAGCCAGG + Intergenic
1121987361 14:98520389-98520411 GAGTTTGGCAGCACAGACAGTGG + Intergenic
1122474192 14:101995142-101995164 GAGTATTTCATCACAGAGCTGGG - Intronic
1123833581 15:24166164-24166186 GAATTTGGTATCCCAGTGCAGGG + Intergenic
1126913658 15:53441570-53441592 GTCTTTGGCATCAGTGAGCAGGG - Intergenic
1129070091 15:72943636-72943658 GAGATTGGTATCATAGAGCCAGG + Intergenic
1129543356 15:76369910-76369932 GAAGATGGCATCACAGAGCAAGG + Intronic
1133070924 16:3246405-3246427 GAGTCTGGAATCACAGACCCCGG + Intronic
1133430714 16:5734655-5734677 GTGTTTGGCACCAAAGAGGAAGG - Intergenic
1135059357 16:19257816-19257838 GAGTCTGACAGCACAGTGCAGGG - Intronic
1136453642 16:30368875-30368897 GAGTTCCCCATCAAAGAGCAGGG + Intronic
1138432188 16:56976005-56976027 GAGAGAGGCATCACAGAGCCGGG - Intronic
1139540097 16:67608492-67608514 GAGTTTGGCTTCAAAAAACAAGG + Intronic
1140250939 16:73293728-73293750 GGGTTGGGCAGCACAGGGCAAGG + Intergenic
1142105544 16:88300487-88300509 GAGTATGGCAGCACCGAGCATGG - Intergenic
1142154171 16:88525735-88525757 GTGTTGGGCACCACAGAGCGAGG + Intronic
1142834230 17:2572912-2572934 GATTTTGGCACCAAAAAGCATGG - Intergenic
1143026124 17:3942924-3942946 GAGTTGGGCTGCACACAGCATGG - Intronic
1143034338 17:3985871-3985893 GAATTTGCCAACACAGAGCCAGG - Intergenic
1144739567 17:17574034-17574056 GCTTCTGGCATCACAGAGCTGGG + Intronic
1151001238 17:70379401-70379423 GAGGATGGTATCACAGAGAATGG + Intergenic
1151143432 17:72016949-72016971 GAGTATGGCATGACAGGGTAAGG - Intergenic
1152614567 17:81331801-81331823 GATTTTGCCAGCACAGAGCAGGG + Intergenic
1155354564 18:24939839-24939861 GAATTTGGCATTACTTAGCATGG + Intergenic
1155667914 18:28333857-28333879 GAGGATGGCATGACAGAGGATGG + Intergenic
1157767040 18:50307277-50307299 GAGTTTCGGATCACAAAGCTGGG + Intergenic
1158223791 18:55179533-55179555 GAATTTGGCATTTCAGAACATGG - Intergenic
1160003417 18:75049279-75049301 GAGATTGGCATCATGGAGCTAGG + Intronic
1160349710 18:78166272-78166294 GAGTTTGGATTCAGAGAGCCAGG - Intergenic
1161580303 19:5077239-5077261 GCGTGTGGGAGCACAGAGCACGG - Intronic
1162159213 19:8698946-8698968 GAGATGAGCATCTCAGAGCAGGG + Intergenic
1162542757 19:11307817-11307839 TATTTTGACAACACAGAGCAGGG + Intronic
1163170262 19:15526237-15526259 GAGTTTGGAATCCCAGGGCAGGG + Intronic
1163310181 19:16509591-16509613 GAGCTGGGCATCACAGGGAAAGG + Exonic
1164100086 19:22047090-22047112 GAGAGTGTCATCACAGAGCCTGG - Intergenic
1164570477 19:29371141-29371163 AAGCTTGGCATCACTCAGCATGG + Intergenic
925991177 2:9255803-9255825 GATGTTTGCATCACATAGCAGGG + Intronic
927024972 2:19058079-19058101 GAGTTGGGAAACACAGGGCATGG - Intergenic
927050465 2:19323035-19323057 TGGTTTTGAATCACAGAGCATGG + Intergenic
928234703 2:29529548-29529570 GAGTTTGGGATCACAAAGGATGG - Intronic
928297679 2:30098826-30098848 GAGTTAGGCAGGACAGGGCAGGG + Intergenic
929250811 2:39753007-39753029 GAATTTGGCATGACGGAGGAAGG - Intronic
929491058 2:42396700-42396722 AAGTTGGGGGTCACAGAGCATGG + Intronic
930382582 2:50650226-50650248 AGGTCTGGCATCACAAAGCATGG - Intronic
931221981 2:60296445-60296467 GTCTTTGGCATCAGAGAGGAAGG - Intergenic
934476557 2:94597417-94597439 GGGCTTAGCATCACAGAGCCCGG - Intronic
935183852 2:100714271-100714293 GACATTTGCATGACAGAGCATGG + Intergenic
935995401 2:108766090-108766112 AAGTTTGGCAATACAGAGCAAGG + Exonic
944081062 2:195789012-195789034 GAGAATGGCATTAGAGAGCATGG - Intronic
944662617 2:201933969-201933991 GAGCTGGGCTTCACAGAGGAAGG - Intergenic
944973421 2:205020274-205020296 GAGGTTTGCATCACACAGCTTGG + Intronic
946669774 2:222090225-222090247 GATTTGGGCTTCACACAGCATGG - Intergenic
948606925 2:239141652-239141674 CAGCTTGACATCAGAGAGCAGGG - Intronic
1170932054 20:20777905-20777927 GAGTTTACCATCTCAGACCATGG - Intergenic
1173715075 20:45196822-45196844 GAGGTTGGGATCACTGTGCATGG - Intergenic
1174940760 20:54924016-54924038 AAGTTTGGCATCACCAAGAAGGG + Intergenic
1175937591 20:62521295-62521317 ATGTTTGGAATCACACAGCATGG + Intergenic
1177275265 21:18904162-18904184 GAGTTTTGATTCACAGAGTATGG - Intergenic
1178804464 21:35826836-35826858 GAGTTTGGCATCACAGAGCATGG - Intronic
1181890008 22:26054149-26054171 CTGCTTAGCATCACAGAGCAAGG + Intergenic
1182450607 22:30418374-30418396 GAGTGTGGAATCCCAGACCAGGG + Intronic
1183820671 22:40343675-40343697 GAGTTTGCCATCAATGAGCAAGG + Intergenic
1184808772 22:46814380-46814402 GATTTTGACGTCACAGAGCCAGG + Intronic
1185019577 22:48366363-48366385 GTGTTGGCCATCACAGAGGAAGG + Intergenic
949291134 3:2467303-2467325 TAGTTTGGCCTCTCAGTGCAAGG + Intronic
952402551 3:32976445-32976467 GAGTTCCCCATCACAGTGCAAGG - Intergenic
953782464 3:45883832-45883854 GAGTAGGCCATCACAGAGCAAGG + Intronic
955511564 3:59685910-59685932 GCGTTGGGGATCAGAGAGCATGG - Intergenic
961633707 3:128319766-128319788 GAGGATGGCAGCACAGTGCAGGG - Intronic
961916594 3:130381713-130381735 GAATTTGGCAGCACACAACATGG + Intronic
965200022 3:165645963-165645985 GAGGTTGCAATCACAGAGTATGG - Intergenic
965208708 3:165756111-165756133 GAGTTCTGTACCACAGAGCATGG + Intergenic
965418305 3:168425240-168425262 GATTTTGGCACCAAAAAGCAGGG + Intergenic
965695307 3:171401758-171401780 GGATTTGGCATGAAAGAGCAAGG + Intronic
966957227 3:184895378-184895400 GAGTTTTGAAATACAGAGCATGG + Intronic
967522411 3:190448859-190448881 GAATTGGCCATCAGAGAGCATGG + Intronic
970353997 4:15234385-15234407 GAGATTGGCAGCAAAGAGCCTGG - Intergenic
970469015 4:16357349-16357371 GATTTTAGCATGACAGAGAATGG + Intergenic
974157427 4:58092422-58092444 TAGTTTTGCATCCCGGAGCAAGG + Intergenic
975195355 4:71518129-71518151 GAGTTTGGGATCATAGAGGCTGG + Intronic
976615036 4:87067834-87067856 CAGTTTGGATGCACAGAGCATGG + Intronic
979203564 4:118008026-118008048 GAGTTTGGCACAACAGTGCATGG + Intergenic
980070209 4:128235622-128235644 GAGTCTGGCATCAGAGGACAGGG - Intergenic
981760226 4:148186541-148186563 GACTTTGGTATCTCAGAGCAGGG - Intronic
982698027 4:158626057-158626079 GACATAGGCATCACACAGCAAGG + Intronic
984568137 4:181355820-181355842 GAGTGTGGCTTCACATAACAGGG + Intergenic
985000876 4:185481195-185481217 CAGTTTGGCATCAAAAAGAAAGG - Intergenic
985888586 5:2699074-2699096 GTGACTGGCAACACAGAGCAAGG + Intergenic
988434019 5:31152380-31152402 GAGTATGGCATCAAAGAGGCAGG - Intergenic
992372821 5:76162571-76162593 GAGTTCAGCATCACAGAGGTTGG - Intronic
992497201 5:77305541-77305563 GAGTTTCCCAGCATAGAGCAGGG + Intronic
992994466 5:82318706-82318728 AAGATTGGCAACACAGAGAAGGG + Exonic
994215827 5:97136063-97136085 GAGTTTGGCTCTAAAGAGCATGG + Intronic
998046652 5:138992401-138992423 GATTTTGGCTTCACAGAGGAGGG - Intronic
998094089 5:139387654-139387676 CAGGATGGCAGCACAGAGCAAGG + Exonic
998779530 5:145640881-145640903 GAGTGTGGCATTACAAATCAAGG + Intronic
999671690 5:153964420-153964442 GGGTGTGGCATCGCAGAGCAGGG - Intergenic
1001200450 5:169711286-169711308 GAGGTGGGCAGCACAGAGCCAGG + Intronic
1002161785 5:177318407-177318429 GATTTTGGAATCACAGAGCTTGG + Intergenic
1003102252 6:3185757-3185779 GCTTTTGGAATCACAGTGCATGG - Intergenic
1007050733 6:38825915-38825937 GAGTTTGACACCACAGCCCATGG - Intronic
1007470009 6:42083696-42083718 GACTCTGCCATCACAGAGGAGGG + Intronic
1011254338 6:85405608-85405630 GAGGTTGTCTGCACAGAGCAGGG - Intergenic
1011712768 6:90071370-90071392 GGCTATGGCATCACAGAGGAGGG + Intronic
1012950429 6:105512398-105512420 GAGTTTGGCAGAGCACAGCAAGG + Intergenic
1014257398 6:119175440-119175462 GTGTCTGGCAGCACAGAGGAAGG + Intergenic
1017052329 6:150405249-150405271 GAGTTTGGCGTTTCAGGGCAAGG - Intronic
1017373237 6:153737193-153737215 GAGTTAGGCACCACAGAGACTGG + Intergenic
1017587906 6:155947183-155947205 GCTTTGGGCATCACTGAGCATGG + Intergenic
1019663550 7:2239732-2239754 CAGGTTGGCATCACACAGAACGG + Intronic
1019762794 7:2826031-2826053 GAGTTTGCATTCCCAGAGCAGGG - Intronic
1021507966 7:21406144-21406166 GAGTTTGGCTTCATAGAGAAGGG - Intergenic
1022431154 7:30322353-30322375 GAGTTTCACATCACAGTGAAGGG + Intronic
1027126053 7:75557534-75557556 TCGGTTGGCATCACACAGCAGGG - Intronic
1030289876 7:107861567-107861589 GAGTTCAGCATCACCGAGCGTGG + Intergenic
1031007895 7:116495504-116495526 GAGTTTGAGGGCACAGAGCAAGG - Intronic
1035386760 7:158478138-158478160 GAGTGGGTCATCACACAGCACGG + Intronic
1036615444 8:10384042-10384064 CTGTATGGCTTCACAGAGCAAGG - Intronic
1037203128 8:16282295-16282317 CAGAGTGGCATCACAGAGGAAGG - Intronic
1039224679 8:35375519-35375541 TGGTTTGCCATCACTGAGCATGG - Intronic
1040664007 8:49609291-49609313 GAGGTTGGCAAAAAAGAGCAGGG + Intergenic
1041570716 8:59334054-59334076 GAGGGTGGTATCACATAGCAAGG - Intergenic
1042193546 8:66212381-66212403 GACTTGGGCATCTCACAGCATGG - Intergenic
1042681236 8:71387157-71387179 GATTTTGGGAGCACAGAGTAGGG + Intergenic
1044888664 8:96808373-96808395 GAGCCTGGCTACACAGAGCATGG + Intronic
1047606930 8:126484281-126484303 GATTTTTGCATCACAGAACTGGG - Intergenic
1047691053 8:127355076-127355098 CAGTTTGGCAGAACAGAACAGGG - Intergenic
1047902735 8:129441830-129441852 GAATTTGTGATCAGAGAGCAGGG - Intergenic
1048779048 8:137981111-137981133 GAGGTGTGCATCAAAGAGCAGGG - Intergenic
1049175025 8:141186941-141186963 GAGTGTGGGGTCTCAGAGCACGG - Intronic
1052853476 9:33392481-33392503 GGGCTTAGCATCACAGAGCCCGG + Intronic
1052857070 9:33414096-33414118 GCAGTTGGCATCACTGAGCATGG - Intergenic
1053931493 9:43116991-43117013 GGGCTTAGCATCACAGAGCCCGG + Intergenic
1054392612 9:64628665-64628687 GGGCTTAGCATCACAGAGCCCGG + Intergenic
1054427260 9:65133874-65133896 GGGCTTAGCATCACAGAGCCCGG + Intergenic
1054503116 9:65887666-65887688 GGGCTTAGCATCACAGAGCCCGG - Intronic
1056550262 9:87647199-87647221 GGGTTTGTCATCACACAGGAAGG + Intronic
1057571950 9:96211173-96211195 GTTTTTGGCTTCACTGAGCATGG + Intergenic
1058996202 9:110300965-110300987 AACTTTGGCATCATAGAGCTGGG + Intergenic
1060356278 9:122911478-122911500 GAGTCTGACATCAGAGAGAAAGG - Exonic
1185567054 X:1102773-1102795 CAGTTGAGCATCACAGACCATGG - Intergenic
1186780188 X:12904331-12904353 GCTTTTGGCCTCACAGTGCAGGG + Intergenic
1188341810 X:29012059-29012081 GATTTTGGCACCACAGTGCATGG + Intronic
1191685133 X:63881894-63881916 GATTTTTGCATCACTGGGCAAGG + Intergenic
1191821492 X:65313898-65313920 CACCTTGGCCTCACAGAGCATGG - Intergenic
1192848724 X:74931298-74931320 GGCTTTGGCAGCACTGAGCAAGG + Intergenic
1195706064 X:107738780-107738802 GAGCTTGGCTTCCCAGAGCTAGG + Intronic