ID: 1178807367

View in Genome Browser
Species Human (GRCh38)
Location 21:35850907-35850929
Sequence CTGAGTCTGCAAATATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 273}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178807367_1178807376 9 Left 1178807367 21:35850907-35850929 CCCAGAAATATTTGCAGACTCAG 0: 1
1: 0
2: 2
3: 25
4: 273
Right 1178807376 21:35850939-35850961 GAGTGAGAAGTGGAGTTGGCTGG 0: 1
1: 0
2: 1
3: 44
4: 395
1178807367_1178807375 5 Left 1178807367 21:35850907-35850929 CCCAGAAATATTTGCAGACTCAG 0: 1
1: 0
2: 2
3: 25
4: 273
Right 1178807375 21:35850935-35850957 GCGGGAGTGAGAAGTGGAGTTGG 0: 1
1: 0
2: 0
3: 30
4: 342
1178807367_1178807374 -1 Left 1178807367 21:35850907-35850929 CCCAGAAATATTTGCAGACTCAG 0: 1
1: 0
2: 2
3: 25
4: 273
Right 1178807374 21:35850929-35850951 GCAGGGGCGGGAGTGAGAAGTGG 0: 1
1: 1
2: 3
3: 99
4: 996

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178807367 Original CRISPR CTGAGTCTGCAAATATTTCT GGG (reversed) Intronic
902167040 1:14580989-14581011 CTGAGTCTCCCAATATTTAGAGG - Intergenic
904106942 1:28092868-28092890 ATGGGTGTGCAAATATCTCTTGG - Intergenic
904428501 1:30446922-30446944 CTCACTCAGCAAACATTTCTTGG + Intergenic
905331509 1:37203837-37203859 CTGGGTGTACAAATATCTCTTGG - Intergenic
909923378 1:81409372-81409394 TTGAATCTGCAAATATGTCCTGG + Intronic
910912541 1:92253084-92253106 CCGGCTCTGCAAATATTTCATGG + Intronic
911334758 1:96569311-96569333 CCAAGTGTGCAAATATTTCCAGG + Intergenic
911442315 1:97942643-97942665 TTAAGTCTCAAAATATTTCTAGG - Intergenic
912147733 1:106814691-106814713 CTGATTCTGCAGAGATTTATAGG - Intergenic
912780303 1:112540547-112540569 CTGAGTCTGCACTTGATTCTGGG - Intronic
916930934 1:169577332-169577354 TTGAGTCTGCATATTTTTCAGGG - Intronic
918746923 1:188214079-188214101 CTGAATCTGCAAATAGCTTTGGG + Intergenic
920415946 1:205799490-205799512 CTGAGTCTGCTCATATTGCCAGG + Intronic
920844325 1:209581098-209581120 CTGGCTCTGCAAATGTTTATTGG - Intergenic
922172101 1:223164381-223164403 CTGAGTATGAAAACATTTATGGG + Intergenic
922713843 1:227855341-227855363 TTGATTCTGCAGATTTTTCTAGG - Intergenic
923452953 1:234136963-234136985 TTCATTCTGCAAATATTTATTGG + Intronic
923850954 1:237794119-237794141 CTGAGTCTTTAGATTTTTCTTGG - Intronic
923870150 1:237983781-237983803 CTAAGTCTGATAAGATTTCTTGG - Intergenic
924919959 1:248618411-248618433 CTTCCTCTGCAAATCTTTCTGGG - Intergenic
1062916534 10:1244560-1244582 CTGAATATGCAAACACTTCTTGG - Intronic
1063792907 10:9475150-9475172 CTCAGTCTGCTGGTATTTCTAGG - Intergenic
1065489975 10:26272962-26272984 CTGTGTGTACAAATAATTCTAGG - Intronic
1066112953 10:32213371-32213393 CAGAGACTGAAAATATTTCCAGG + Intergenic
1066557024 10:36625406-36625428 TTGACACTGCAATTATTTCTTGG + Intergenic
1068141659 10:53016127-53016149 CTGAGTCTGAAACTCTTTCATGG + Intergenic
1068378543 10:56215975-56215997 CTGATACTGGAAATATTCCTAGG - Intergenic
1069083764 10:64115936-64115958 TTGAGTCTGCAAAGGTTTCTAGG + Intergenic
1070601137 10:77867178-77867200 CTGAGTAGGAAGATATTTCTTGG - Intronic
1071570500 10:86694156-86694178 CAGAGCCTGCAAATATTCCAGGG - Intronic
1072984297 10:100126310-100126332 ATCAGTATGCAAAAATTTCTGGG + Intergenic
1074441965 10:113485733-113485755 ATGTGTCTGTAAATATATCTTGG - Intergenic
1075520605 10:123141463-123141485 CTGCCTCTGCAAAGATTACTAGG + Intergenic
1075641290 10:124066397-124066419 CTGCTTCTGCATCTATTTCTGGG + Intronic
1075880293 10:125845441-125845463 TTTAGTCTGCAATTATTCCTGGG + Intronic
1076438360 10:130462045-130462067 CTGAATCTGTAAATATCTGTAGG + Intergenic
1077071611 11:676474-676496 CTGATTCTGCGAACATTTCAGGG - Intronic
1077947249 11:6913508-6913530 TTTAGTCTGGAAATAATTCTGGG + Intergenic
1077965377 11:7126204-7126226 CTGAGTCTGTAGATATATTTTGG + Intergenic
1078970199 11:16401236-16401258 CAGAATCTGCAAACCTTTCTTGG - Intronic
1079226797 11:18613893-18613915 CTTATTCAGCAGATATTTCTTGG - Intronic
1079853402 11:25567603-25567625 CTGAGGCTGCTCATATTTTTAGG + Intergenic
1080305619 11:30831692-30831714 CTGAGCCTCCCAATATTCCTAGG - Intronic
1080389231 11:31828497-31828519 TATAGTCTGAAAATATTTCTAGG + Intronic
1082217425 11:49589543-49589565 ATTAGTCTACAAATATTTATTGG + Intergenic
1082681361 11:56175720-56175742 CTGAGACTTCAAATAATTTTAGG - Intergenic
1083052505 11:59789797-59789819 TTCAGTCTACAGATATTTCTTGG + Intronic
1085983544 11:81755487-81755509 TTTATTCAGCAAATATTTCTTGG + Intergenic
1086632137 11:89034611-89034633 ATTAGTCTACAAATATTTATTGG - Intronic
1087502158 11:98971427-98971449 CTGAATCTTCACAGATTTCTGGG - Intergenic
1087527072 11:99328987-99329009 CTGAGGCTGCATGAATTTCTTGG + Intronic
1087986564 11:104688951-104688973 ATGAAACTGAAAATATTTCTAGG + Intergenic
1090265105 11:125348657-125348679 CTGCTGCTACAAATATTTCTGGG + Intronic
1091081782 11:132677103-132677125 TTCAGTCTCCACATATTTCTTGG - Intronic
1091621223 12:2090699-2090721 CTGGGCATGCAAATATCTCTTGG + Intronic
1093604646 12:21074824-21074846 CAGAGGCTGAAAATAGTTCTGGG + Intronic
1096531608 12:52246138-52246160 GTGAGTCTGCAAATATCTCTGGG - Intronic
1096908359 12:54957356-54957378 CAGAGTCTGTAATTATTTCCTGG - Intronic
1096989060 12:55783704-55783726 CTGAGTCTGCTATTTTTCCTAGG - Intronic
1098726554 12:73975137-73975159 CTAACTAAGCAAATATTTCTTGG + Intergenic
1099603601 12:84772902-84772924 CAGAGTCTGTAAATATTCTTAGG + Intergenic
1100158025 12:91824515-91824537 CTGAGTCTGCACAGATGTGTAGG + Intergenic
1100864236 12:98839201-98839223 CTTATTCAACAAATATTTCTTGG + Intronic
1102925687 12:116824319-116824341 CTCATTCAGCAAATATTTCTTGG + Intronic
1103290204 12:119839381-119839403 CTGAGCGTGCAAACATTTCAAGG - Intronic
1106030800 13:26000603-26000625 CTAAGACTGCACATATCTCTGGG + Intronic
1106158751 13:27182094-27182116 ATGAGTGTGCAAATATCTGTTGG - Intergenic
1108771184 13:53702026-53702048 ATGAGTGTGCAAATATCTCTTGG - Intergenic
1109130674 13:58581099-58581121 CCTTGTCTGCAAATATTTCCTGG - Intergenic
1109746298 13:66627466-66627488 CTGACTCTCTTAATATTTCTAGG + Intronic
1111244365 13:85516016-85516038 CTGAGACAGCAAATATTGCCAGG - Intergenic
1111738566 13:92173779-92173801 CACATTCTGCAAATATTTGTTGG - Intronic
1112169024 13:96950294-96950316 CAGAGTTTGCAAATATTTTCTGG - Intergenic
1112289852 13:98136188-98136210 CTGAGTCTGAATCTCTTTCTTGG + Intergenic
1112727410 13:102320379-102320401 CTGACCCTGCAAACACTTCTGGG + Intronic
1112748761 13:102558323-102558345 CTATCTCTGCAAATATTTCAAGG - Intergenic
1112751576 13:102588902-102588924 CTGAGTCTGCAACTTGCTCTTGG + Intergenic
1112804787 13:103152007-103152029 TTTAATGTGCAAATATTTCTGGG + Intergenic
1112863074 13:103858567-103858589 ATAAGTCTGCAAATATTAATAGG + Intergenic
1113482449 13:110631508-110631530 CTGATGCTGCAAACCTTTCTAGG + Intronic
1114345918 14:21794937-21794959 TAGAGGCTGCACATATTTCTTGG - Intergenic
1114563616 14:23611583-23611605 CTTATTCTACAAATATTTATTGG + Intergenic
1114798850 14:25748118-25748140 CTAAATCTGCAAAGACTTCTGGG + Intergenic
1114811011 14:25899518-25899540 CATAGTCTGGAAATATTTGTAGG - Intergenic
1116010633 14:39347530-39347552 CTGAGTCTGCCAGAATTTCTAGG + Intronic
1116335257 14:43649063-43649085 CTAAGCCCCCAAATATTTCTTGG + Intergenic
1120011438 14:79420119-79420141 CTGAGAATGCAAATAGCTCTTGG + Intronic
1120463570 14:84827194-84827216 CAGAGCTTGCAGATATTTCTTGG - Intergenic
1121928967 14:97954740-97954762 TTGGCTATGCAAATATTTCTGGG + Intronic
1123635041 15:22297017-22297039 CTGAATCTGCAGATATCTTTAGG - Intergenic
1125308495 15:38350709-38350731 CTCAGACTACAACTATTTCTTGG - Intronic
1126333645 15:47562807-47562829 CTGAATTTACAAAAATTTCTGGG - Intronic
1127128165 15:55833853-55833875 CTGGGTCTGTAACTATTACTAGG - Intronic
1128764659 15:70243826-70243848 CTGGGCCTGAAAACATTTCTCGG + Intergenic
1130737580 15:86566282-86566304 TTGAGTATGCACATTTTTCTAGG + Intronic
1130831913 15:87609680-87609702 GTGACTCTGCAAATTTGTCTGGG + Intergenic
1132365015 15:101251154-101251176 CCGAGTCTGCAGGTATTTCTGGG + Exonic
1133410118 16:5561213-5561235 TAGAGTCTGCTCATATTTCTTGG - Intergenic
1133867698 16:9659460-9659482 CTTAGTGTGCATATATTTATAGG + Intergenic
1135475749 16:22773039-22773061 CTCATTCAGCAAACATTTCTGGG + Intergenic
1139179901 16:64734513-64734535 ATGTGTCTGCAGATATTTTTAGG - Intergenic
1140294006 16:73690251-73690273 CTGAGTCTGCAAATCTAGTTTGG - Intergenic
1140622166 16:76747993-76748015 GTTAGTCTGTAAATATTACTGGG - Intergenic
1142423695 16:89989314-89989336 CTGTGAATGCAAATATTTCTGGG - Intergenic
1143645864 17:8229651-8229673 CTTAACATGCAAATATTTCTTGG - Intronic
1144082895 17:11780932-11780954 CTGAGACAGCAAAGATTTCAAGG - Intronic
1147788797 17:42999837-42999859 CTGAGGGTGGAAATATTTTTTGG + Intronic
1149119519 17:53145319-53145341 TTGAGTCTGAAGATATTTCTGGG - Intergenic
1150472005 17:65445456-65445478 CTGAGACTCCCAATATCTCTAGG + Intergenic
1152292738 17:79449417-79449439 GTGAGTCTGCAAAATTTCCTGGG + Intronic
1152675956 17:81641376-81641398 CTGAGTCTTCAGATCTTCCTCGG - Intronic
1153489992 18:5636951-5636973 CTGTGTTTGGAAATATTTCTAGG - Intergenic
1153958360 18:10118232-10118254 ATGATTCTGCAGATATTTCTAGG - Intergenic
1155689508 18:28601254-28601276 CTGAGACAGCAAGTATTGCTAGG - Intergenic
1155706403 18:28820169-28820191 TTGAGTCTGTAAATCTTTTTGGG + Intergenic
1156682500 18:39608086-39608108 CTGTGTAAGCAAATATTTATAGG - Intergenic
1158075692 18:53526202-53526224 CTAACTCTGCAAATCTTCCTTGG + Intronic
1159112773 18:64079036-64079058 CTGAGCCTCCACATATTTTTTGG + Intergenic
1159473406 18:68885880-68885902 CTGAGTTTGTCAGTATTTCTCGG + Intronic
1160440847 18:78891262-78891284 CTGAGTGTAAAAATGTTTCTAGG - Intergenic
1163078836 19:14920943-14920965 CTGAGTCTGAATATATTTGTGGG + Intergenic
1163377525 19:16942631-16942653 CTGAGTCAGCAGAGGTTTCTTGG - Intronic
1165931802 19:39363970-39363992 CTGAGGCTGCACAAATTACTTGG + Intronic
1166401116 19:42480963-42480985 CTGAGTCAACAAGTATTTCCAGG - Intergenic
1166699993 19:44876899-44876921 CTGAGTCTGTTCATATGTCTAGG - Intronic
925578577 2:5385796-5385818 CTTTGTCTTCAAATATTTCAAGG - Intergenic
926431577 2:12792103-12792125 CTTAGTCAGTAAATATTTTTAGG + Intergenic
926479387 2:13371325-13371347 CTGAATCTGCAGATATCTTTAGG - Intergenic
926849822 2:17183417-17183439 ATGGGACTGCATATATTTCTTGG - Intergenic
927371809 2:22364477-22364499 CTGAGTCTTTAGATTTTTCTAGG + Intergenic
929394333 2:41505197-41505219 CATAGTATGCAAATATTCCTGGG - Intergenic
930034512 2:47077053-47077075 GTCACTGTGCAAATATTTCTTGG + Intronic
930807329 2:55503813-55503835 CTGTGGCTGCCAAAATTTCTGGG + Intergenic
931464443 2:62474332-62474354 CTGTGGCTGCAAACATTTCAGGG - Intergenic
933335199 2:80949239-80949261 CTGAGTATCCAAGTACTTCTGGG + Intergenic
933736670 2:85500922-85500944 CTGATTTTCCAAATTTTTCTTGG + Intergenic
933897711 2:86826018-86826040 CTTGGTCTGCAAATGTTTCAAGG - Intronic
935854873 2:107262711-107262733 CATACTCTGCAATTATTTCTAGG - Intergenic
936032505 2:109083613-109083635 ATGGGTGTGCAAATATCTCTCGG + Intergenic
936417604 2:112331756-112331778 GTGAGTCTCCAAATTGTTCTAGG - Exonic
937627553 2:124060481-124060503 CTGAGTTTGCAAATTCTGCTGGG - Intronic
938833681 2:135078099-135078121 CTGAATTTGCAATTATTTCTTGG - Intronic
939363273 2:141201394-141201416 GTGAGTCAGAAAATGTTTCTTGG - Intronic
939906660 2:147924576-147924598 CTGACTCTGAAATTATTTCATGG - Intronic
941244844 2:163084070-163084092 CTGAATCTTCAATTCTTTCTGGG + Intergenic
941713543 2:168740374-168740396 GTGAGTTTTCAAATATTTGTAGG - Intronic
942403037 2:175623371-175623393 CTGACTCTACAAAGCTTTCTGGG + Intergenic
944141244 2:196459504-196459526 CTGAGTTTTCAAGGATTTCTGGG - Intronic
944399775 2:199312018-199312040 CTGATACTGCAAAACTTTCTTGG - Intronic
946850505 2:223901956-223901978 CTAACTCTGGAAATATTTCCAGG + Intronic
947083110 2:226420757-226420779 CTGAATCAGCAAATCTTTCAAGG - Intergenic
949038964 2:241836445-241836467 CTGAGTCTTGAATTATCTCTTGG - Intergenic
1169726585 20:8740497-8740519 CTGAGTCACCATATATTTTTGGG + Intronic
1170734461 20:19002231-19002253 CTCAGTCTGGAAATGTCTCTAGG - Intergenic
1172064358 20:32208391-32208413 TTGATTCAGCAAATATTTATGGG + Intronic
1172825056 20:37774980-37775002 CTGAGACTGAGAATGTTTCTTGG + Intronic
1173390213 20:42625093-42625115 CTGATTCTGCAGTTATTTGTGGG - Intronic
1175195174 20:57238411-57238433 ATGGGTGTGCAAATATCTCTTGG + Intronic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177443518 21:21160702-21160724 CTGAGTATGGTAAAATTTCTAGG + Intronic
1178807367 21:35850907-35850929 CTGAGTCTGCAAATATTTCTGGG - Intronic
1178824236 21:36002138-36002160 TTGACTCTGTTAATATTTCTGGG - Intronic
1181839124 22:25639732-25639754 CTGAATCTACAAATTATTCTGGG + Intronic
1182657470 22:31902182-31902204 ATGAGTCAGTAGATATTTCTTGG + Intronic
1183437343 22:37803652-37803674 CTGTGTCTGCAAACAGCTCTTGG + Intergenic
1184253357 22:43273393-43273415 GTGGCTCTGCAAATGTTTCTTGG - Intronic
1184854703 22:47140206-47140228 CTGAGTCTGCCTATTCTTCTCGG + Intronic
949518883 3:4831699-4831721 AAGATTCTGCAAACATTTCTAGG + Intronic
950827583 3:15841276-15841298 CTGACTGGGCAAAGATTTCTTGG + Intronic
956280997 3:67556610-67556632 CTGTATCTGCATATATTTCTTGG + Intronic
957231604 3:77524520-77524542 TTTAGTCAGCAAATATTTTTCGG - Intronic
957884875 3:86273962-86273984 CTGATTATGCAGAAATTTCTAGG - Intergenic
957901871 3:86504806-86504828 CAGAGGCTGGAAATATTGCTTGG + Intergenic
960619765 3:119626646-119626668 GTGAGTTTGGAGATATTTCTCGG + Intronic
962963611 3:140333855-140333877 ATGGAGCTGCAAATATTTCTGGG - Intronic
964273417 3:154983381-154983403 CTGAGTTTTTAAATATTCCTGGG - Intergenic
964603084 3:158525006-158525028 TTGAGTATGCAAAGATTTTTTGG + Intronic
965170777 3:165261541-165261563 CTGAGACACCAAATATTTCAGGG - Intergenic
965240695 3:166193124-166193146 CAGAGTCTGCAAGAATTCCTAGG - Intergenic
965619532 3:170629030-170629052 CTTAATCAGCAAATATTTATTGG + Intronic
968327169 3:197828303-197828325 ATGAGTTGGCAAAAATTTCTAGG - Intronic
969500570 4:7550173-7550195 CTGAGGCTGCAAATGTTTGATGG + Intronic
972131986 4:35848801-35848823 CTGAATATGCAAAAATTTCTGGG - Intergenic
972561244 4:40230873-40230895 GTGACTCTGAAAATTTTTCTAGG - Intronic
972907896 4:43773711-43773733 ATGAGTGTGCAAATGTCTCTTGG - Intergenic
972994781 4:44866683-44866705 CAGAGTCTTCAAGTTTTTCTAGG + Intergenic
973756922 4:54084024-54084046 CTGAGGCTTGAACTATTTCTAGG - Intronic
974429916 4:61782822-61782844 CTATGTCTGTCAATATTTCTGGG - Intronic
974708569 4:65557444-65557466 TTGATTCAGCAAATATTTATAGG + Intronic
975210455 4:71693598-71693620 TTGAGTCTGCATACATTTTTTGG - Intergenic
975553805 4:75639920-75639942 ATGAGACTTCAAACATTTCTAGG + Intergenic
975961227 4:79908129-79908151 CTTTGTTTTCAAATATTTCTTGG - Intronic
976939743 4:90685266-90685288 CTGAGTCTGGAAGTGTTGCTTGG - Intronic
977078545 4:92491139-92491161 GTGATTCAGCAAATATTTATCGG - Intronic
977350043 4:95872367-95872389 TACATTCTGCAAATATTTCTTGG - Intergenic
977911872 4:102546633-102546655 CTAGGTCAGCAAATATTTCCAGG - Intronic
978319050 4:107473383-107473405 CTGGATCTGCAAATAATTTTTGG - Intergenic
978635915 4:110806704-110806726 GTTAATCTGCAAATATCTCTAGG - Intergenic
978635999 4:110807973-110807995 GTTAATCTGCAAATATCTCTAGG + Intergenic
980563844 4:134511656-134511678 CTCAGTTAGAAAATATTTCTAGG - Intergenic
980694971 4:136342619-136342641 TTGAGTCTGTAAATATCTTTGGG - Intergenic
980867997 4:138576383-138576405 CTGAGGCTGAGAAAATTTCTAGG + Intergenic
980961836 4:139483079-139483101 CTGAAGCTGCAAATATATCTTGG + Intergenic
981171360 4:141627441-141627463 TGGAGTAGGCAAATATTTCTTGG - Intergenic
981272802 4:142864345-142864367 ATGAGTGTGCAAATATCTCAAGG + Intergenic
981437142 4:144737672-144737694 CTTATTCAGCAAATATTTGTTGG + Intronic
981881677 4:149620481-149620503 CAGTGTCTGTAAATATGTCTGGG - Intergenic
981909866 4:149966638-149966660 GTGATTCTGCAAATATGTATGGG + Intergenic
982140190 4:152310110-152310132 ATGTCTCTGCAAATATTTTTAGG - Intergenic
986158681 5:5202850-5202872 ATGAGTCTGCCTATATTTCTTGG - Intronic
986183506 5:5416242-5416264 CTGATTCAGCAATCATTTCTTGG + Intergenic
986201658 5:5584745-5584767 GTAAATCAGCAAATATTTCTAGG + Intergenic
987063532 5:14265534-14265556 CTCATTGTGAAAATATTTCTAGG + Intronic
989021068 5:37009982-37010004 CTGTGTTTGCCAATATTTCTAGG - Intronic
990117082 5:52402488-52402510 CTGATTCTGCAAGTACTTCAAGG - Intergenic
990894875 5:60688055-60688077 TTCATTCAGCAAATATTTCTAGG + Intronic
991150913 5:63368721-63368743 TTCAGTTTTCAAATATTTCTTGG - Intergenic
992160935 5:74000983-74001005 TTGAGTCTGCAAAATATTCTTGG + Intergenic
994688548 5:102987802-102987824 CTGAATTTGCAAATAATCCTAGG - Intronic
995590239 5:113692510-113692532 CTGGGTCTAGAAATAATTCTAGG - Intergenic
999920222 5:156310108-156310130 CTGAGCCTGCAAATTTACCTGGG + Intronic
999972703 5:156880843-156880865 CTGAAGCGGCAATTATTTCTGGG - Intergenic
1000363748 5:160472210-160472232 CGGACACTGCAAATATTCCTAGG + Intergenic
1001167639 5:169385086-169385108 CTCAGTCTGCGAACAATTCTTGG - Intergenic
1003828307 6:9976504-9976526 TTGAGGCTGCAAAGAGTTCTTGG - Intronic
1003937638 6:10992238-10992260 CTGATACTCCAAATATCTCTGGG + Intronic
1006042048 6:31264440-31264462 TTGTGTGTGGAAATATTTCTGGG - Intergenic
1006051584 6:31349280-31349302 TTGTGTGTGGAAATATTTCTGGG - Intronic
1007873996 6:45074337-45074359 TTGGGTATGCAAAGATTTCTTGG + Intronic
1007955087 6:45910892-45910914 CAGAGTCTCCATTTATTTCTGGG + Intronic
1008298367 6:49805237-49805259 CTGAGTTTGCAAAAATTCCTGGG - Intergenic
1009882403 6:69584713-69584735 CTGAGTCTGGATTTATTTCATGG - Intergenic
1010059876 6:71610466-71610488 TTCAGTCAGCAAATATTTTTTGG + Intergenic
1010112873 6:72262118-72262140 CTCAGTGTGTGAATATTTCTAGG + Intronic
1010464758 6:76154123-76154145 CTGAGTCTGGAAAAATGTGTAGG + Intergenic
1012614172 6:101255182-101255204 CTAGGTCTGAAAATATTTCTAGG + Intergenic
1013734208 6:113206701-113206723 CTGAATCTGCAATTTTCTCTCGG + Intergenic
1014898953 6:126940018-126940040 TTGACTCTATAAATATTTCTTGG + Intergenic
1014997184 6:128163063-128163085 CTGCATTTACAAATATTTCTTGG - Intronic
1016522004 6:144956044-144956066 CTGAGACTGCAAATACAGCTTGG + Intergenic
1016719723 6:147281996-147282018 CTCATTCTACAAATATTTATTGG + Intronic
1017530159 6:155281922-155281944 CTGAGAATCCACATATTTCTGGG - Intronic
1017628110 6:156368799-156368821 TTTATTCTGCAAATATTTTTAGG - Intergenic
1017632782 6:156413729-156413751 TTGAGGCTGCCCATATTTCTTGG - Intergenic
1018959754 6:168440297-168440319 CTGGGTGTGCAAAAATTTCCTGG + Intergenic
1020566428 7:9801981-9802003 ATGAGAGTGCAAATATCTCTTGG - Intergenic
1020601561 7:10280733-10280755 CTGAGTCTACAAATCTATATTGG - Intergenic
1020714883 7:11660144-11660166 ATGAGTTTGTAAATTTTTCTAGG - Intronic
1020811202 7:12852195-12852217 ATGGGTGTGCAAATATTTATTGG + Intergenic
1021311471 7:19103102-19103124 TTCAGTCAGCAAACATTTCTTGG - Intronic
1021516554 7:21494704-21494726 CTGAATCTGCAGATATGTTTGGG - Intronic
1022284148 7:28939036-28939058 CTGATTCAGAAAATATTTTTAGG + Intergenic
1022948150 7:35308319-35308341 CTGAATCTGCAAATACCTCCAGG - Intergenic
1024186547 7:46954144-46954166 CTGGGTCTGCAGATATAACTGGG - Intergenic
1026048364 7:66923579-66923601 CTGCCTCTGCCAATATTTCTAGG - Intronic
1027401035 7:77807758-77807780 CTGACTTGGCAATTATTTCTTGG - Intronic
1027884010 7:83879809-83879831 CAGATTATGCAAATATTTTTAGG - Intergenic
1028738761 7:94248473-94248495 CCAAGTCTGGAAATATTTCTAGG - Intergenic
1029225107 7:99020534-99020556 CTGAGCCTGCATATTTCTCTAGG - Intergenic
1030601659 7:111600051-111600073 CTCAGTCTGGAAAAATTTGTGGG - Intergenic
1032617534 7:133490941-133490963 CTGAGGCTGGAAATATTGGTAGG + Intronic
1034409166 7:150929901-150929923 CTGAGTCTGATAAAAATTCTAGG + Intergenic
1038109019 8:24473738-24473760 TTGGGTTTGCAAATATTTTTTGG - Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1043658398 8:82702862-82702884 CGCATTCTGCAAATATTACTTGG + Intergenic
1043669626 8:82865821-82865843 ATGTGTTTGCAAATATATCTTGG + Intergenic
1044167058 8:88998506-88998528 CTAATTCTGCAAATATTGATTGG - Intergenic
1045116718 8:98990816-98990838 CTCAGTCCCCATATATTTCTGGG + Intergenic
1046741254 8:117831472-117831494 CTGAGTCTGGTAAGTTTTCTGGG + Intronic
1046842418 8:118874400-118874422 CTCATTCTGCAAATATTTATTGG + Intergenic
1047121970 8:121914798-121914820 CTGAATCTGCAAAGATTTCATGG + Intergenic
1047839134 8:128729765-128729787 CTGAATCTGCAAATAGCTTTTGG + Intergenic
1048425904 8:134323295-134323317 CTAAGTCTGCAAAGGCTTCTAGG - Intergenic
1048888570 8:138928582-138928604 TTCACTCTGCAAATATTTGTCGG - Intergenic
1049853533 8:144847680-144847702 CTCATTCAGCAAACATTTCTGGG - Intronic
1050783240 9:9366048-9366070 CTGAGGCTACAAAAATTCCTAGG + Intronic
1051279424 9:15426520-15426542 CTCATTCTACAAATATTTGTTGG - Intronic
1051883639 9:21866430-21866452 ATGAGTAGGCAAAGATTTCTTGG - Exonic
1052600209 9:30617757-30617779 ATCAGTTTGCAAATATCTCTTGG - Intergenic
1056019096 9:82423066-82423088 CTGAGTTTGCAAATCTATCTTGG + Intergenic
1056263399 9:84872187-84872209 CTGAGTTTGTAAATTTTACTGGG - Intronic
1056813415 9:89781983-89782005 ATGTGTCTGCAAATAGATCTGGG + Intergenic
1057329478 9:94099687-94099709 TTCAGTCAGCAAATATTTCCTGG + Intronic
1057445110 9:95108388-95108410 CTGGGTCTGCAAAAATGTCAGGG + Intronic
1057698355 9:97343730-97343752 CTGTGACTGCAAATAATTCCTGG - Intronic
1058555401 9:106161358-106161380 CTGACTCTGCCAATTTGTCTTGG + Intergenic
1058735906 9:107893861-107893883 CTGAGTCTGAAAATATTAAATGG + Intergenic
1059092227 9:111371759-111371781 CTGAGACTGCAAAGCCTTCTGGG + Exonic
1060589966 9:124810484-124810506 CCCAGTCCGCAAATATTTATTGG + Exonic
1060746966 9:126143564-126143586 AAGAGTATGCAAATATCTCTTGG + Intergenic
1187682130 X:21778242-21778264 CAGTGTCTGGAAATATTTTTTGG - Intergenic
1188123698 X:26341394-26341416 CTGTTTCAGCAAATATTTCTTGG - Intergenic
1189361026 X:40351492-40351514 CTGAGCCTGCACATAGTCCTGGG + Intergenic
1190814970 X:53921868-53921890 CAGAGTCTGCAAATATTTTTAGG + Intergenic
1193057804 X:77173336-77173358 CTCAGTCTGGAAAGACTTCTGGG + Intergenic
1194948738 X:100099359-100099381 CTGCGTGTGCAAATATCACTTGG + Intergenic
1195007891 X:100704676-100704698 CTGTGTCTCCAACTATTTCCTGG - Intronic
1195290442 X:103427549-103427571 ATGTGTTTTCAAATATTTCTTGG + Intergenic
1195532620 X:105973661-105973683 CAGAGTTTGAAAATATTTCTTGG - Intergenic
1195911633 X:109894091-109894113 ATGGGAGTGCAAATATTTCTTGG + Intergenic
1201243685 Y:11982677-11982699 CTGTGTCTGGAAACATTTTTTGG + Intergenic