ID: 1178808372

View in Genome Browser
Species Human (GRCh38)
Location 21:35858623-35858645
Sequence CAGAATGGAGTGCTTATATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178808372_1178808375 25 Left 1178808372 21:35858623-35858645 CCTAATATAAGCACTCCATTCTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 1178808375 21:35858671-35858693 CCTCCTCAAATCAGTCAGTGAGG 0: 1
1: 0
2: 0
3: 31
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178808372 Original CRISPR CAGAATGGAGTGCTTATATT AGG (reversed) Intronic
901570550 1:10156586-10156608 CAGAATTGGGTGCAGATATTGGG + Intronic
902868847 1:19300180-19300202 GAGAATGGAGTGGTTATCTTTGG - Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
910308933 1:85801123-85801145 CTGAAAGGAGTGATTATAATAGG - Intronic
911469039 1:98293604-98293626 CAGAATGGAATACTTACATAAGG - Intergenic
912736137 1:112151008-112151030 CACAATGAAGTGCTTTGATTAGG + Intergenic
913292323 1:117285248-117285270 CAGAATGGAATGCTAATCCTTGG - Intergenic
913940133 1:125095340-125095362 AAGAATGAAGTACTTATATGTGG + Intergenic
915646036 1:157273406-157273428 CAGAATGAGGGGTTTATATTGGG + Intergenic
916401277 1:164451663-164451685 CATAATGTAGTACGTATATTGGG - Intergenic
917777000 1:178348654-178348676 CAAACTGGAGCGCTTATAATAGG - Intronic
917910376 1:179638557-179638579 CAGAATGTATTGTGTATATTTGG - Intronic
921130405 1:212214963-212214985 CAGAATGAGGGGTTTATATTGGG + Intergenic
923488064 1:234455312-234455334 CAGAATGGAGTCCTAGAATTGGG - Intronic
1068885886 10:62096782-62096804 CAAAATTGAGTGTTTATAGTTGG - Exonic
1072740901 10:97908476-97908498 CAAAATGGCGTGCTTAGAGTTGG - Intronic
1073360925 10:102897939-102897961 CAGAAAGGAGACCTTATGTTGGG - Intronic
1074031868 10:109697053-109697075 CAGAAAGGAGATCTTATTTTCGG - Intergenic
1079658740 11:23015640-23015662 CTGAAAGCAGTGCTTTTATTGGG + Intergenic
1083797848 11:65027955-65027977 GAGAATGGAGTACTAATATTTGG - Intronic
1085792364 11:79507063-79507085 CAGAATGAGGGGTTTATATTGGG - Intergenic
1086002809 11:82001488-82001510 CATAATGGAGGGCTTATGTGGGG - Intergenic
1094620526 12:32076205-32076227 CAGAATGGATTCCTTAGCTTTGG + Intergenic
1095537879 12:43273335-43273357 CAGAGTGCATTGCATATATTAGG - Intergenic
1096790040 12:54038890-54038912 CAGGGTGCAGTGCTCATATTGGG - Intronic
1098088763 12:66878483-66878505 CAGATTGGAGTGATGATGTTAGG + Intergenic
1098914616 12:76244227-76244249 CAGAATGCAGTGCTTGCATGGGG - Intergenic
1098998014 12:77144218-77144240 CAGAATGGAGTATTTTGATTTGG + Intergenic
1099068835 12:78019521-78019543 AAGTATGAAGTGCTTATAATTGG + Intronic
1101683138 12:106988411-106988433 CATAATAGAGTTTTTATATTCGG - Intergenic
1105670528 13:22609154-22609176 CACAATGTAGTGTTTTTATTGGG - Intergenic
1106804795 13:33295190-33295212 CAGATTGGTGGTCTTATATTAGG - Intronic
1109953273 13:69530654-69530676 CAGGTTGTAGTCCTTATATTTGG - Intergenic
1110131455 13:72016768-72016790 CAGTATGATGTGCTGATATTTGG + Intergenic
1110725962 13:78823961-78823983 GAACATGAAGTGCTTATATTTGG + Intergenic
1112057786 13:95706766-95706788 AAGAATGGAATCCTTAAATTTGG - Intronic
1117225258 14:53651866-53651888 CAGAATAGACTGGTTAGATTTGG - Intergenic
1125346090 15:38720567-38720589 CTGAATGAAGTGCTTAAAATAGG + Intergenic
1126325797 15:47475956-47475978 CTGAATGGAGGGCCTATAGTGGG + Intronic
1128160385 15:65419905-65419927 CAGAATGAAGGGCTGGTATTGGG - Intronic
1131639180 15:94271383-94271405 CATAATGATGTGATTATATTTGG + Intronic
1133426481 16:5694735-5694757 CAGAATGGTGTGATGATAGTGGG - Intergenic
1136481021 16:30541872-30541894 CAGAATGAGGGGTTTATATTGGG + Intronic
1136482098 16:30548429-30548451 CAGAATGAGGGGTTTATATTGGG + Intronic
1136698435 16:32108260-32108282 AAGAATGAAGTACTTATATATGG - Intergenic
1136769166 16:32819572-32819594 AAGAATGAAGTACTTATATATGG + Intergenic
1136798939 16:33051556-33051578 AAGAATGAAGTACTTATATATGG - Intergenic
1136956626 16:34794509-34794531 AAGAATGAAGTACTTATATATGG - Intergenic
1138333150 16:56231285-56231307 CTGAATGGAGTTCTTTTCTTGGG - Intronic
1138810275 16:60140878-60140900 TAGAATGGAGTCCTTGTTTTAGG - Intergenic
1140588070 16:76318152-76318174 CAGAATGGAGACCTTATTCTAGG - Intronic
1141113291 16:81287886-81287908 CAGTATGGAGAGTTTTTATTGGG + Intronic
1203071584 16_KI270728v1_random:1081679-1081701 AAGAATGAAGTACTTATATATGG + Intergenic
1146125604 17:30228933-30228955 CAGCATGGAGGGCTTGTTTTGGG + Intronic
1151637883 17:75364809-75364831 TAGAATGGAGAGATTAGATTGGG - Intronic
1151994477 17:77600116-77600138 CTGAATGGAGGGCTCATATTCGG + Intergenic
1151995384 17:77605130-77605152 CAGAAAGGAGTGATTAAATTAGG - Intergenic
1153521531 18:5958858-5958880 CAGGTTGAATTGCTTATATTTGG - Intronic
1157377748 18:47181973-47181995 TAAAATGGAGTGCTTTTAATAGG - Intergenic
1159534293 18:69695486-69695508 CAAAATGGAGTGGTTAAAATTGG - Intronic
1202672248 1_KI270709v1_random:66607-66629 AAGAATGAAGTACTTATATATGG - Intergenic
928788868 2:34926685-34926707 CAGAATGTTGTGTTTATACTAGG - Intergenic
929656832 2:43741511-43741533 CAGAATGGCTTTCTTACATTGGG + Intronic
929834546 2:45383138-45383160 ATTAATGGAGTGCTTATGTTGGG - Intergenic
930810455 2:55534864-55534886 CAGGATGCAGTGCTTAATTTCGG + Intronic
934249205 2:90333732-90333754 AAGAATGAAGTACTTATATATGG + Intergenic
934260374 2:91469742-91469764 AAGAATGAAGTACTTATATATGG - Intergenic
934303689 2:91801684-91801706 AAGAATGAAGTACTTATATATGG - Intergenic
934329566 2:92051068-92051090 AAGAATGAAGTACTTATATATGG + Intergenic
934467785 2:94280980-94281002 AAGAATGAAGTACTTATATATGG + Intergenic
937522136 2:122724704-122724726 CTGAAAGGAGAGCTTATGTTCGG + Intergenic
937666040 2:124487821-124487843 CAAAATCGAATGCTTATACTAGG + Intronic
938908665 2:135864307-135864329 CAAAATGGAGTGTTTATGATTGG - Intronic
941086507 2:161124335-161124357 CAGACTGGTGTGCTTATAAGAGG + Intergenic
941194630 2:162433732-162433754 GAAAATGGAATGCTTATATTGGG + Intronic
941604367 2:167578908-167578930 CAGAATGGAGCGTGTATAATAGG + Intergenic
942188408 2:173446730-173446752 CAGATTAGAGAGATTATATTAGG + Intergenic
942219402 2:173754827-173754849 CAGAATCGAGTGTTCATATTAGG + Intergenic
1170956392 20:20983903-20983925 CAAAATGTAGTGCTTGGATTTGG + Intergenic
1170974323 20:21148148-21148170 CAGAATGGAGGACCTGTATTGGG + Intronic
1174582998 20:51585945-51585967 CTGAGTGGAGTGTCTATATTAGG - Intergenic
1176586081 21:8587353-8587375 AAGAATGAAGTACTTATATATGG - Intergenic
1177878422 21:26663639-26663661 TGTAATGGAGGGCTTATATTTGG - Intergenic
1178808372 21:35858623-35858645 CAGAATGGAGTGCTTATATTAGG - Intronic
1179262199 21:39767613-39767635 CACAATGGCATGCTTTTATTGGG - Intronic
1180268888 22:10564259-10564281 AAGAATGAAGTACTTATATATGG - Intergenic
1184393295 22:44218124-44218146 CAGAATGGGGTGCTCCTAATGGG + Intronic
950357051 3:12420482-12420504 CAGAAAGAAGTGCTTTTGTTGGG + Intronic
952150969 3:30591271-30591293 CAGAATGGAGTGCATAGAATTGG + Intergenic
954023762 3:47765639-47765661 CAGAATGGAGAGACTATCTTTGG - Intronic
954369878 3:50164572-50164594 GAGAGTGGGGTGCTTAAATTTGG + Intronic
956158310 3:66321429-66321451 TAGTATGGAGTGCTGATAGTTGG + Intronic
957385123 3:79486615-79486637 CACAATTAAGTGCTAATATTGGG + Intronic
961337515 3:126190745-126190767 CAGAAAGGAGTTCATTTATTTGG + Intronic
961741658 3:129036783-129036805 GAGAATGGAGTCCTTAGAGTGGG + Intronic
963505585 3:146180705-146180727 CAGAATGGAGTAATTTAATTTGG + Intergenic
964677781 3:159302973-159302995 CATTATTGAGTGCTTATATGAGG + Intronic
966019786 3:175194397-175194419 CAGAATTTAGTTCTTAGATTGGG - Intronic
966019898 3:175195949-175195971 CTGAATAAAGAGCTTATATTTGG + Intronic
966437672 3:179906802-179906824 CAGTCTAGAGTTCTTATATTTGG - Intronic
966535519 3:181029123-181029145 CAGATTAGAGAGCTTATATGAGG - Intergenic
970538711 4:17056060-17056082 CAGCATGGGGTGCTTATGGTAGG - Intergenic
972787077 4:42336450-42336472 CAAAATGGAGTCTTTAGATTTGG - Intergenic
974355282 4:60804640-60804662 ATGTATGGATTGCTTATATTTGG - Intergenic
975239610 4:72042397-72042419 CAGAATGGGGTGCTGCTATAAGG + Intronic
975481144 4:74881804-74881826 CAAGATGAAGTGCTTATATTAGG + Intergenic
976442169 4:85088382-85088404 TAGAGTGGAGTGCTAATATAAGG + Intergenic
976678002 4:87724738-87724760 CAGAATGCAGTGCTGCTATAAGG + Intergenic
978047890 4:104154914-104154936 CAAAATGGTGTACTTATATAGGG - Intergenic
978949711 4:114543260-114543282 CACATTGAAGTGCTTGTATTTGG - Intergenic
983112847 4:163774355-163774377 CATAATGAAGTGATTATCTTTGG + Intronic
986055541 5:4133060-4133082 CAGAGTGGAGTGGGCATATTGGG + Intergenic
987628300 5:20432343-20432365 CAGACTGGAATGCTAATAGTTGG + Intronic
988427157 5:31077030-31077052 CAGCATGGAGTGGTTTTATCTGG + Intergenic
992411661 5:76511111-76511133 CAGAATGTAGTCCATATAATAGG - Intronic
994021649 5:95033115-95033137 TAGAATTGAGGGCTTTTATTTGG - Intronic
994903890 5:105811156-105811178 TAGAAAGGAGTGTTTATATCAGG + Intergenic
996009656 5:118467902-118467924 CAGAATGGAATGCTTTATTTTGG - Intergenic
998169526 5:139864302-139864324 AATTATGGAGTGCTTTTATTTGG - Intronic
999687160 5:154113251-154113273 CTGAATGTTGTGATTATATTGGG - Intronic
1001861012 5:175055288-175055310 AATAAAGGAGTCCTTATATTTGG - Intergenic
1003066169 6:2904913-2904935 CAGCATGAAATGCCTATATTAGG + Intergenic
1004053439 6:12111217-12111239 CAGAAGTGAGTGCATATGTTTGG + Intronic
1009051686 6:58283462-58283484 CAGAATGAGGGGTTTATATTGGG + Intergenic
1012606415 6:101163374-101163396 AAGAATGGAGTGCTTCTTTAGGG - Intergenic
1014127863 6:117797559-117797581 CAGAATAAAGTTGTTATATTCGG - Intergenic
1018744710 6:166752976-166752998 CAGAATAAATTGCTTATAGTCGG - Intronic
1023997647 7:45171817-45171839 CAGAAGGGATTGACTATATTTGG - Intronic
1025481136 7:60984449-60984471 AAGAATGAAGTACTTATATATGG - Intergenic
1030417663 7:109265646-109265668 CAAAATGCAGTGAATATATTTGG - Intergenic
1030781624 7:113608285-113608307 CAGAATGGAGAAGTTTTATTTGG + Intergenic
1031183881 7:118451526-118451548 AAGAATTGAGTGCTTCTACTTGG + Intergenic
1031374086 7:121003479-121003501 TAGGAAAGAGTGCTTATATTTGG + Intronic
1032151190 7:129431557-129431579 TAAAGTGGAGTGCTTATATGGGG + Intergenic
1033890726 7:146009634-146009656 AAGAATTGGGTGCTTATGTTTGG + Intergenic
1040498688 8:47989098-47989120 CAGAATGAGGGGTTTATATTGGG + Intergenic
1040500234 8:47998878-47998900 CAGAATGAGGGGTTTATATTGGG + Intergenic
1042497538 8:69471727-69471749 CAGATAGGAGTACTTATCTTGGG + Intronic
1043452228 8:80379513-80379535 CAGAATGGAGTAAATATTTTTGG + Intergenic
1044355595 8:91219145-91219167 CAGATTGTAGTGCTTAGATTGGG - Intronic
1044478789 8:92660466-92660488 CAGAAGGAAGTACTTATTTTGGG + Intergenic
1045176825 8:99734602-99734624 CAGAATAAAGTGCTTATTTATGG - Intronic
1045616974 8:103926801-103926823 CAGAATGTTGTGCCTTTATTAGG - Intronic
1046607140 8:116383782-116383804 CAGATTGGAAGGCTTATATTTGG - Intergenic
1046609016 8:116403617-116403639 CAGAATGGAGTGGTTACATAAGG - Intergenic
1047447470 8:124932244-124932266 CAGAAGGGCTTGCTTATATCTGG + Intergenic
1047518315 8:125574734-125574756 CAGAGGTGAGTGATTATATTTGG - Intergenic
1048783681 8:138028177-138028199 GAGAATTGAGTGGTTTTATTAGG + Intergenic
1051424504 9:16919875-16919897 GGGGATGGAGTGCTTTTATTTGG + Intergenic
1052534815 9:29733092-29733114 CAGAATGGAGTCTGTACATTTGG - Intergenic
1052592227 9:30513381-30513403 CAGAGTGGGGTGTTTATATAAGG + Intergenic
1053523271 9:38803685-38803707 TATAATGGACTGTTTATATTTGG + Intergenic
1055707727 9:79025367-79025389 CAGAATGGTGTGCTTTTATAGGG - Intergenic
1061588934 9:131585653-131585675 CAGGATGGAGTGCTTCTGTGGGG + Intronic
1203615986 Un_KI270749v1:64869-64891 AAGAATGAAGTACTTATATATGG - Intergenic
1187241628 X:17519342-17519364 CAGTATGGAAGGCTTATTTTGGG + Intronic
1192776417 X:74250277-74250299 CAGAATGAGGGGTTTATATTGGG - Intergenic
1193071791 X:77314408-77314430 CAGACTGGAGTGTTCCTATTTGG - Intergenic
1193322894 X:80144746-80144768 CAGAATGAAATGCATATATCTGG - Intergenic
1194492812 X:94571758-94571780 CAGAATGAGGGGTTTATATTGGG - Intergenic
1195004685 X:100674109-100674131 CAGAAAGAAGTGCTTATAGCAGG + Intergenic
1197968726 X:132093172-132093194 CAGAATGCAGTGCTTAGATAGGG - Intronic
1199729343 X:150615696-150615718 CAACATTGTGTGCTTATATTTGG + Intronic
1200782725 Y:7231472-7231494 AAGATTGGATTGCTTAAATTGGG + Intergenic