ID: 1178809441

View in Genome Browser
Species Human (GRCh38)
Location 21:35867868-35867890
Sequence GACTCACAGTTCCACGTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22098
Summary {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178809438_1178809441 17 Left 1178809438 21:35867828-35867850 CCTGAGACTGGGTAATTTATAAA 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181
Right 1178809441 21:35867868-35867890 GACTCACAGTTCCACGTGACCGG 0: 36
1: 862
2: 5111
3: 8006
4: 8083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178809441 Original CRISPR GACTCACAGTTCCACGTGAC CGG Intronic
Too many off-targets to display for this crispr