ID: 1178819048

View in Genome Browser
Species Human (GRCh38)
Location 21:35958683-35958705
Sequence AAGGGCATTGTGACCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178819048_1178819054 1 Left 1178819048 21:35958683-35958705 CCCACAGAGGTCACAATGCCCTT 0: 1
1: 1
2: 1
3: 6
4: 144
Right 1178819054 21:35958707-35958729 ACTGAATGTGGCTCCATGGTTGG 0: 1
1: 0
2: 0
3: 13
4: 120
1178819048_1178819056 15 Left 1178819048 21:35958683-35958705 CCCACAGAGGTCACAATGCCCTT 0: 1
1: 1
2: 1
3: 6
4: 144
Right 1178819056 21:35958721-35958743 CATGGTTGGATAACTTATGCAGG 0: 1
1: 0
2: 0
3: 3
4: 68
1178819048_1178819053 -3 Left 1178819048 21:35958683-35958705 CCCACAGAGGTCACAATGCCCTT 0: 1
1: 1
2: 1
3: 6
4: 144
Right 1178819053 21:35958703-35958725 CTTGACTGAATGTGGCTCCATGG 0: 1
1: 0
2: 1
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178819048 Original CRISPR AAGGGCATTGTGACCTCTGT GGG (reversed) Intronic
901061038 1:6472009-6472031 CAGGGCAGTGTGACCTCGGGAGG - Intronic
901514108 1:9733710-9733732 AGGGGCATTCTTCCCTCTGTGGG + Intronic
902116396 1:14125160-14125182 AAGGGCATCCTGTGCTCTGTGGG + Intergenic
902985351 1:20151270-20151292 AAGGGCTTTGTGAGCTGAGTGGG + Intergenic
903809484 1:26027278-26027300 AAGAGCTGTGTGACCTCTTTGGG + Intronic
904856007 1:33498801-33498823 AAGGGCATTGGCTCCTCTGAAGG + Intergenic
907158849 1:52357126-52357148 AGGGGCCTTGTGACCTGGGTAGG - Exonic
909783208 1:79575428-79575450 ATGGGCAGTGTGACCTCTTGGGG - Intergenic
911801682 1:102147438-102147460 CAGGGGCTTGTGACTTCTGTGGG + Intergenic
922291368 1:224211504-224211526 AAGGGCATTTTGAAGTCTGGAGG - Intergenic
922460679 1:225812458-225812480 AAGGGCATCTTGACCACTGCAGG + Intronic
922548558 1:226476682-226476704 AAGGGTTTTGTGATCTCTGCAGG - Intergenic
922932735 1:229403069-229403091 AGGGCCCGTGTGACCTCTGTGGG - Intergenic
924351849 1:243122187-243122209 AAGGGCCTGGTGACCTCTTCGGG + Intergenic
1063107571 10:3006633-3006655 AATGGCTTTGTGACATCTTTGGG - Intergenic
1070387557 10:75939620-75939642 AAGTGGAATGTGACCTCTCTAGG - Intronic
1072718700 10:97767845-97767867 ATGCGCATTTTGACCACTGTGGG + Exonic
1074127293 10:110539320-110539342 TAGGGAATTCTGGCCTCTGTGGG - Intergenic
1077069677 11:662931-662953 ATGGGCATCGTGCCCTCTGGGGG - Intronic
1078361630 11:10673734-10673756 TAGTGCCTTGTGACCTCTCTGGG + Intronic
1078421593 11:11217215-11217237 TAGGCCATTGTATCCTCTGTGGG - Intergenic
1081666643 11:44920591-44920613 AAGGGCATTGTGAACTCATAAGG - Intronic
1082477097 11:53334415-53334437 GAGGGCATTGAGGCCTGTGTTGG + Intergenic
1082479383 11:53367572-53367594 AAGGGCTTTGAGGCCTGTGTTGG + Intergenic
1082830943 11:57616733-57616755 AAGGTGATTCTGACCCCTGTGGG + Intergenic
1088349645 11:108871352-108871374 AAGGGCATCCTGCCCTCTGCTGG + Intronic
1090362436 11:126182978-126183000 AAGGGCATTGCCACCTCTCACGG + Intergenic
1092117409 12:6019174-6019196 AAGGTCATTGTGATCCCGGTGGG - Exonic
1093840395 12:23892380-23892402 CAGGGCATTGTGTCCACAGTAGG + Intronic
1100228351 12:92581792-92581814 AATGGCATGGTGAATTCTGTGGG + Intergenic
1101079989 12:101172489-101172511 AAGGGCAGAGTGACCTCTACTGG - Intronic
1104034154 12:125087022-125087044 ACGGGCATTAGGAGCTCTGTGGG + Intronic
1104440178 12:128787844-128787866 AAGGGAATTGGGACCTCCTTAGG - Intergenic
1104555616 12:129797461-129797483 ATGCGCACAGTGACCTCTGTGGG - Intronic
1105306749 13:19174275-19174297 AAGGGCTTAGTGACATTTGTGGG - Intronic
1108521429 13:51250371-51250393 AAGGGAATTGAGACATCTTTAGG - Intronic
1112154820 13:96805761-96805783 AATTGCATTGTGACCTCCGTTGG - Intronic
1112251237 13:97782443-97782465 AAGGGGCTTGTTAGCTCTGTGGG - Intergenic
1112932790 13:104762641-104762663 ACACGCCTTGTGACCTCTGTGGG + Intergenic
1113996487 14:16082072-16082094 AAGCACTTTGTGGCCTCTGTTGG - Intergenic
1114000088 14:18228080-18228102 AAGGGAATGTTCACCTCTGTGGG + Intergenic
1115965668 14:38884760-38884782 AAGAGCATGGAGACCTCTATAGG - Intergenic
1116194098 14:41700158-41700180 GAGGGACTTGTGACCACTGTTGG + Intronic
1117784599 14:59269570-59269592 AAGGGCATTTTGATTTCTATTGG + Intronic
1202947189 14_KI270726v1_random:39719-39741 AAGCTCATTTTCACCTCTGTGGG - Intergenic
1124609331 15:31197538-31197560 AAGGGCACCGTGACCTCAGAGGG - Intergenic
1124807129 15:32896387-32896409 AGTGGCATTATGTCCTCTGTTGG - Intronic
1124834947 15:33187494-33187516 TAGGGTCTTGTGACCTCTCTGGG - Intronic
1125657773 15:41372232-41372254 AAGGGCACTGTGCCCCTTGTGGG + Intronic
1126094471 15:45078197-45078219 TAGGGCATTTTGCTCTCTGTAGG - Intergenic
1126424796 15:48515685-48515707 CAGTGCAATGTGATCTCTGTTGG - Intronic
1136906893 16:34101974-34101996 GAGGGCTTTGTGACCTATGTTGG - Intergenic
1136967871 16:34937261-34937283 ATGTGCACTGTGAGCTCTGTGGG - Intergenic
1137553549 16:49456236-49456258 AAGGGCACTGAGACCTTCGTGGG - Intergenic
1137963994 16:52913028-52913050 AAGGGCTATATGACCTCTGGAGG - Intergenic
1140001779 16:71032235-71032257 AAGAGTATTGTGCCTTCTGTTGG - Intronic
1141710281 16:85695005-85695027 AAGGGGACTGGGTCCTCTGTGGG + Intronic
1148017386 17:44531666-44531688 AAGGTCAGTGTGACCTCTGGAGG - Intergenic
1148603450 17:48910581-48910603 AAGGGCATTGTTTCCTCAGGGGG - Intronic
1148990981 17:51667196-51667218 AAAGGAATTGTGACTTCTGATGG + Intronic
1153331683 18:3880569-3880591 AAGAGCTCTGTCACCTCTGTGGG + Intronic
1158676915 18:59528896-59528918 AAGTATCTTGTGACCTCTGTTGG + Intronic
1162397844 19:10427809-10427831 AAGGGCATTGAAACCTTGGTCGG + Intronic
1167167573 19:47809761-47809783 AAAGGCATGGGGACTTCTGTGGG - Intronic
926236993 2:11053133-11053155 AAGGTCATTTTTTCCTCTGTTGG + Intergenic
928287380 2:30004703-30004725 GAGGGCCTTGGGACTTCTGTTGG - Intergenic
928935968 2:36678271-36678293 GAGGGCATGGTGACCTCTGCAGG + Intergenic
933285506 2:80380672-80380694 AAGTGCATTGTAATCTCTGCAGG - Intronic
933737125 2:85504182-85504204 AAGGGCACTGTGACCTCTGTGGG - Intergenic
936507647 2:113120484-113120506 AAGGGCACTGGTACCTCTGGTGG - Intronic
937099181 2:119255465-119255487 AAGTGCATTGTGATCTCTTAGGG - Intronic
938317076 2:130337390-130337412 AAGGGGATTCTGGCTTCTGTGGG - Intergenic
940728742 2:157365048-157365070 CACTGCATTGTGACCCCTGTAGG + Intergenic
947340660 2:229135231-229135253 AAGAGCATTGTCATCTCTGCGGG - Intronic
1170395470 20:15921148-15921170 AAGGGCTTTGTGCCCTTTGCTGG - Intronic
1171734616 20:28761241-28761263 GAGCGCTTTGTGGCCTCTGTTGG - Intergenic
1171734695 20:28763078-28763100 AAGTGCTTTGTAGCCTCTGTTGG - Intergenic
1171742891 20:28923513-28923535 AAGCCCTTTGTGACATCTGTTGG - Intergenic
1171884785 20:30644060-30644082 AAGAGCTTTGTACCCTCTGTGGG - Intergenic
1173398128 20:42700228-42700250 AAGGGCAAGGTGACTTCCGTGGG - Intronic
1173402992 20:42741205-42741227 AAGGTCATGGTAACTTCTGTTGG + Intronic
1174455449 20:50645570-50645592 AAGGGCACTGGGAACCCTGTGGG + Intronic
1176324421 21:5376119-5376141 GAGTGCTTTGTGGCCTCTGTTGG + Intergenic
1176481980 21:7306538-7306560 GAGTGCTTTGTGGCCTCTGTTGG + Intergenic
1176482067 21:7308409-7308431 GAGCGCTTTGTGGCCTCTGTTGG + Intergenic
1178819048 21:35958683-35958705 AAGGGCATTGTGACCTCTGTGGG - Intronic
1179226035 21:39454319-39454341 AAGGGCATTCTGACTTCTGTTGG + Intronic
1180310572 22:11225074-11225096 AAGCACTTTGTGGCCTCTGTTGG + Intergenic
1180397807 22:12372651-12372673 GAGGGCTTTGTGACCTATGGTGG - Intergenic
1180401943 22:12491994-12492016 GAGGGCTTTGTGACCTATGGTGG + Intergenic
1180424551 22:15157853-15157875 AAGGGAATGTTCACCTCTGTGGG + Intergenic
1184017036 22:41794110-41794132 AAGAGCATTGTGACCTTGGTTGG - Intronic
1185414683 22:50703648-50703670 TAGGGAATTCTGACCTCCGTGGG - Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
949531272 3:4958061-4958083 ATGGTCATTGTCACCTCTGGGGG + Intergenic
952660872 3:35845215-35845237 AATGGCAGTCTGACCTCTCTGGG - Intergenic
953253330 3:41265803-41265825 AAGGGAATCGTGAAATCTGTGGG + Intronic
955026133 3:55169381-55169403 AGATGCAATGTGACCTCTGTTGG - Intergenic
960452792 3:117831084-117831106 TATGGCACTGTGACATCTGTTGG + Intergenic
961533593 3:127555553-127555575 ATGACTATTGTGACCTCTGTGGG - Intergenic
964122077 3:153195343-153195365 AAGAGCACTGTGACCTAAGTTGG + Intergenic
966650201 3:182292126-182292148 AGGGGCAGTCTGACTTCTGTTGG - Intergenic
968356484 3:198111560-198111582 AAAAGCTTGGTGACCTCTGTTGG + Intergenic
969489879 4:7493083-7493105 ATGGGCATGGTGACCTCAGAAGG - Intronic
971868818 4:32208934-32208956 AAGGGCATAATGTCCTTTGTGGG - Intergenic
973368433 4:49226343-49226365 AAGAGCTTTGTACCCTCTGTGGG - Intergenic
973392614 4:49569082-49569104 AAGAGCTTTGTACCCTCTGTGGG + Intergenic
985773900 5:1830665-1830687 AAGGGCATTGGGACCACTTCTGG - Intergenic
985929351 5:3044529-3044551 AAGGATATTGTGACCTGTGGAGG + Intergenic
986418452 5:7551846-7551868 AAGGCATCTGTGACCTCTGTAGG - Intronic
987837337 5:23178768-23178790 AAGTGTCTGGTGACCTCTGTTGG + Intergenic
989104442 5:37847940-37847962 AGGGGCATTGTGACTTGTCTTGG + Intergenic
989840826 5:46066165-46066187 GAGGGCATTGAGGCTTCTGTTGG + Intergenic
989871740 5:46611408-46611430 AAATGCTTTGTGGCCTCTGTTGG + Intergenic
989873732 5:46648083-46648105 AAAGGCTTTGTGGCCTATGTTGG + Intergenic
989875098 5:46673493-46673515 AAATGCTTTGTGGCCTCTGTTGG + Intergenic
989875783 5:46686288-46686310 AAATGCTTTGTGGCCTCTGTTGG + Intergenic
989876798 5:46705569-46705591 AAATGCTTTGTGGCCTCTGTTGG + Intergenic
989879744 5:46760504-46760526 AAATGCTTTGTGGCCTCTGTTGG + Intergenic
989880013 5:46765453-46765475 AAATGCTTTGTGGCCTCTGTTGG + Intergenic
991917052 5:71615734-71615756 AAGGGTATTAGGAACTCTGTCGG - Intronic
993441760 5:87965108-87965130 TAGGGGATTTTGGCCTCTGTAGG + Intergenic
996036344 5:118762800-118762822 AAGTGCCTGGAGACCTCTGTTGG - Intergenic
998572556 5:143276080-143276102 AAGGGCATTCTGTAATCTGTGGG + Intergenic
1001536689 5:172503051-172503073 AAGGGGAACTTGACCTCTGTTGG - Intergenic
1003311766 6:4975142-4975164 CAGGGCTTTGTGGGCTCTGTAGG - Intergenic
1003740163 6:8927713-8927735 AAGTGCATTCTGTACTCTGTGGG + Intergenic
1006163832 6:32053202-32053224 AAGGGCCCTGTGAGCTCTGTTGG - Intronic
1006415165 6:33899365-33899387 GAGGGCAATGTGGCCTCTCTGGG + Intergenic
1008678491 6:53846230-53846252 AAGGGAATTGTGTGCTGTGTTGG + Intronic
1009715664 6:67391558-67391580 AAGGGCCTTCTGTCCTCTGCAGG + Intergenic
1013257139 6:108398984-108399006 AATGGCATTGTGACTTTGGTGGG + Intronic
1013769470 6:113611549-113611571 GAGGGCTTTGTGAGCCCTGTTGG - Intergenic
1016083248 6:139881078-139881100 AAGAGCAGTGTGACTTTTGTGGG + Intergenic
1022737436 7:33089293-33089315 AAGGGGAGTGTGACCTTGGTGGG + Intergenic
1024513170 7:50218982-50219004 AAGGGCCTTGTGAGGGCTGTAGG + Intergenic
1026036495 7:66833531-66833553 AAGCACATTGTGACCTCTTAAGG - Intergenic
1027146535 7:75699491-75699513 ACGGGGATGGTGACGTCTGTGGG + Intronic
1031372465 7:120984817-120984839 AAGGGCATGGTGAATTTTGTGGG - Intergenic
1037758045 8:21724058-21724080 GAGGGTATTGTCTCCTCTGTGGG - Intronic
1040382607 8:46887410-46887432 AAAGGCTTTGTGACATCTCTGGG - Intergenic
1041073815 8:54150846-54150868 AAGGTAATTGTCACCTGTGTTGG + Intergenic
1041203711 8:55476346-55476368 AGTGGCATTTTGACCTCTGGGGG - Intronic
1050138747 9:2495705-2495727 CAGGACATTGTGACCTTTGAGGG + Intergenic
1053713849 9:40860293-40860315 AAGGGAATGTTCACCTCTGTGGG - Intergenic
1054424233 9:64990641-64990663 AAGGGAATGTTCACCTCTGTGGG - Intergenic
1055130081 9:72765251-72765273 AAAGGCATAGTGATTTCTGTTGG - Intronic
1058114298 9:101067612-101067634 AGGTGGATTGTGACCTCTCTCGG - Intronic
1059970925 9:119667341-119667363 AGGGTCATGGTGACCTCTGCTGG - Intergenic
1060887178 9:127162688-127162710 AGGGGAATTATGAACTCTGTGGG + Intronic
1189865187 X:45320454-45320476 AAGGGCTTTGTGGGCTGTGTTGG + Intergenic
1194917123 X:99720354-99720376 AAAGACATAGTGATCTCTGTGGG - Intergenic
1195319750 X:103711943-103711965 AAGAGCATAATGACCTCTGGGGG - Intronic