ID: 1178820024

View in Genome Browser
Species Human (GRCh38)
Location 21:35966598-35966620
Sequence CTCTACTGTCCAGGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178820024_1178820030 28 Left 1178820024 21:35966598-35966620 CCAAGTTTCCCTGGACAGTAGAG No data
Right 1178820030 21:35966649-35966671 TTCACTGACAAGTGCAATCCTGG No data
1178820024_1178820031 29 Left 1178820024 21:35966598-35966620 CCAAGTTTCCCTGGACAGTAGAG No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data
1178820024_1178820032 30 Left 1178820024 21:35966598-35966620 CCAAGTTTCCCTGGACAGTAGAG No data
Right 1178820032 21:35966651-35966673 CACTGACAAGTGCAATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178820024 Original CRISPR CTCTACTGTCCAGGGAAACT TGG (reversed) Intronic