ID: 1178820027

View in Genome Browser
Species Human (GRCh38)
Location 21:35966606-35966628
Sequence GCCCAAGGCTCTACTGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178820027_1178820033 29 Left 1178820027 21:35966606-35966628 CCCTGGACAGTAGAGCCTTGGGC No data
Right 1178820033 21:35966658-35966680 AAGTGCAATCCTGGGGAAGCAGG No data
1178820027_1178820032 22 Left 1178820027 21:35966606-35966628 CCCTGGACAGTAGAGCCTTGGGC No data
Right 1178820032 21:35966651-35966673 CACTGACAAGTGCAATCCTGGGG No data
1178820027_1178820030 20 Left 1178820027 21:35966606-35966628 CCCTGGACAGTAGAGCCTTGGGC No data
Right 1178820030 21:35966649-35966671 TTCACTGACAAGTGCAATCCTGG No data
1178820027_1178820031 21 Left 1178820027 21:35966606-35966628 CCCTGGACAGTAGAGCCTTGGGC No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178820027 Original CRISPR GCCCAAGGCTCTACTGTCCA GGG (reversed) Intronic