ID: 1178820029

View in Genome Browser
Species Human (GRCh38)
Location 21:35966621-35966643
Sequence AGCACGTAAACGTGTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178820029_1178820035 23 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820035 21:35966667-35966689 CCTGGGGAAGCAGGAGTATGAGG No data
1178820029_1178820036 24 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG No data
1178820029_1178820030 5 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820030 21:35966649-35966671 TTCACTGACAAGTGCAATCCTGG No data
1178820029_1178820031 6 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data
1178820029_1178820033 14 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820033 21:35966658-35966680 AAGTGCAATCCTGGGGAAGCAGG No data
1178820029_1178820032 7 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820032 21:35966651-35966673 CACTGACAAGTGCAATCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178820029 Original CRISPR AGCACGTAAACGTGTGCCCA AGG (reversed) Intronic