ID: 1178820031

View in Genome Browser
Species Human (GRCh38)
Location 21:35966650-35966672
Sequence TCACTGACAAGTGCAATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178820024_1178820031 29 Left 1178820024 21:35966598-35966620 CCAAGTTTCCCTGGACAGTAGAG No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data
1178820029_1178820031 6 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data
1178820027_1178820031 21 Left 1178820027 21:35966606-35966628 CCCTGGACAGTAGAGCCTTGGGC No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data
1178820028_1178820031 20 Left 1178820028 21:35966607-35966629 CCTGGACAGTAGAGCCTTGGGCA No data
Right 1178820031 21:35966650-35966672 TCACTGACAAGTGCAATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178820031 Original CRISPR TCACTGACAAGTGCAATCCT GGG Intronic