ID: 1178820036

View in Genome Browser
Species Human (GRCh38)
Location 21:35966668-35966690
Sequence CTGGGGAAGCAGGAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 422}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178820029_1178820036 24 Left 1178820029 21:35966621-35966643 CCTTGGGCACACGTTTACGTGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG 0: 1
1: 0
2: 2
3: 29
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178820036 Original CRISPR CTGGGGAAGCAGGAGTATGA GGG Intronic
900405149 1:2489737-2489759 CTGGGGGAGGAGGTGCATGATGG - Intronic
900712406 1:4122660-4122682 CTGGGGAGGCGGGAGAAGGAGGG + Intergenic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
902935212 1:19760043-19760065 CTGGGGGAGCAGGACTTGGAGGG - Intronic
903173682 1:21568670-21568692 CTGGGCAAGTAGGAGGATGGAGG + Intronic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
904416252 1:30362760-30362782 CAGGGGAAACAGGAGTGTGGAGG - Intergenic
905018959 1:34795316-34795338 CTGGGGAAGCAGGTGCTTGCTGG + Exonic
905033867 1:34904794-34904816 CCGGGGAAGCGGGACTATAATGG - Exonic
905523012 1:38614575-38614597 ATGGACAAGCAGGAGTGTGAGGG - Intergenic
907045109 1:51295964-51295986 CTGGGGAGGGAGGAGTAGGGTGG - Intronic
907184506 1:52599618-52599640 ATGGGGAAGAAGGAGCAGGATGG + Intergenic
907264807 1:53251295-53251317 CTAGGGAAGCAGCAGCATTAGGG - Intronic
907270802 1:53289934-53289956 GAGGGGAAGCAGGAGTGTGGTGG - Intronic
908845943 1:68324352-68324374 CTGGGGGAGCAGGAATTTGACGG + Intergenic
909858151 1:80567095-80567117 CCAGGGAAGCTGGAGTTTGAAGG + Intergenic
911073846 1:93854207-93854229 TGGGGGAAGCAGTGGTATGAAGG + Intergenic
911440228 1:97917283-97917305 CTGGGGAGGAAGGAGAATCATGG - Intronic
912159113 1:106959517-106959539 CTGGGGCAGCTGGACTATGGGGG - Intergenic
912228927 1:107769703-107769725 CTTGGGAATCAGGAGTCTGTTGG - Intronic
912498622 1:110107257-110107279 TGGGAGAAGCAGGAGCATGAAGG - Intergenic
912753319 1:112303490-112303512 GTGCGGGAGCAGGAGAATGATGG - Intergenic
912804009 1:112741785-112741807 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
915588353 1:156857344-156857366 CTGGAGAGGCAGGGGCATGATGG - Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
916248385 1:162710841-162710863 CTGGAAAGGCTGGAGTATGAAGG - Intronic
916326750 1:163569678-163569700 CTGGGAAAGCAGGACTTTGGGGG - Intergenic
916738371 1:167628122-167628144 CTGGGGACCCAGGAGCATGGTGG + Intergenic
916851664 1:168710718-168710740 TTGGGGAAGCAGAAGTATCCTGG + Intronic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
917671015 1:177273590-177273612 CTTGGTAAGCAGCACTATGATGG + Exonic
918358059 1:183724588-183724610 AGGGGGAGGGAGGAGTATGAGGG + Intronic
918508864 1:185288310-185288332 CTGAGGCAGCAGGATCATGAAGG - Intronic
920663002 1:207933995-207934017 GATGGGAAGCAGAAGTATGATGG + Intergenic
920666160 1:207964132-207964154 CTGGGGTGGCAGGCGTATGTTGG - Intergenic
920916751 1:210263869-210263891 GTGGTAAAGCAGGAGTAGGAAGG + Intergenic
921117804 1:212110928-212110950 CTGGGGAAGAAGGAGAAAGGAGG - Intergenic
921287368 1:213621396-213621418 CAGGGAAAGCAGGAGTTTGTGGG + Intergenic
921304767 1:213784878-213784900 CTAGGGAAGAAGGAGGATGTAGG - Intergenic
921833120 1:219750346-219750368 CTGGGGAAGGCAGAGTAGGATGG + Intronic
922014526 1:221631599-221631621 GGGAGGAAGCAGGAGTGTGAAGG - Intergenic
1062958326 10:1554580-1554602 TGGGGAAAGCAGGAGAATGAAGG - Intronic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1064523980 10:16233593-16233615 CTGGGGAAGAAGGAATCTGTGGG - Intergenic
1065761782 10:28989418-28989440 CTAGGGAAGAAGGTGTATGTTGG - Intergenic
1066246765 10:33591475-33591497 CTGGGCATGCAGGAGTCTGATGG - Intergenic
1067558022 10:47285752-47285774 CTTGGGAGGAAGGAGTATGTGGG + Intergenic
1067566190 10:47339641-47339663 CTGGGCAAGGCGGAGTATGCAGG - Intergenic
1067702531 10:48584015-48584037 CTGGGGACAGAGGAGAATGAAGG - Intronic
1067804300 10:49382467-49382489 CTGGGGATGCAGGAAGATGAGGG + Intronic
1069776516 10:70930322-70930344 CAGGGGAGGCAGGAAGATGAAGG - Intergenic
1069890530 10:71649487-71649509 TTGGGGAAGCTGGAATAGGAAGG + Intronic
1070039112 10:72757407-72757429 TTGGGGAAGTAGGAGGAAGAAGG - Intronic
1070171695 10:73937855-73937877 CTGGGGAAGGAGGAGGATGTTGG + Intergenic
1070706324 10:78641751-78641773 CTTGTGAAGCAGGAGAAAGATGG - Intergenic
1070785990 10:79162486-79162508 CTGGGTGAGCAGGAGCATGTCGG + Intronic
1071604104 10:86972724-86972746 CCGAGGCAGCAGGAGCATGATGG - Intronic
1073087220 10:100900467-100900489 CTGGGGAAGAAGGTATATTATGG - Intergenic
1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG + Intronic
1075489486 10:122854411-122854433 CTTGGGAAGCAGGAGATGGAGGG - Intronic
1075589142 10:123678780-123678802 CAGGGGAAGCAGAACTCTGATGG - Intronic
1075611735 10:123860042-123860064 CTGGGCAAGCAGGAGAAACAAGG + Intronic
1076214195 10:128679725-128679747 CTGGGGTAGCAGTGGTGTGAAGG + Intergenic
1076266598 10:129113749-129113771 CTGGGAAAGAAGGGGTAGGATGG + Intergenic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076516297 10:131046641-131046663 CTGGGGAAGAAGGAGAAGGTAGG + Intergenic
1076582164 10:131518948-131518970 CTGGGGAGGAAGGAGGATGCTGG + Intergenic
1077664038 11:4092557-4092579 GTGGGGGAGCAGGGGTAAGAGGG - Exonic
1078738179 11:14041188-14041210 TTGGGGAAGAAGGAGGATGGGGG - Intronic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1080360088 11:31503100-31503122 CTAGGAAAGCAGGAGTAAGCTGG - Intronic
1080396927 11:31898795-31898817 CTGGGCAAGCAGGAATATAGAGG - Intronic
1080582639 11:33656713-33656735 TGGGGGAAGCTGGAGTAGGAAGG - Intronic
1080590434 11:33718870-33718892 CTGAGGAAGCAAGAGTTGGAAGG + Intronic
1080922605 11:36723753-36723775 CTGGGGCAGTAGGAGTCTGGAGG - Intergenic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083399128 11:62411809-62411831 CTGGGGAAGCAGGAGTGGGAAGG - Intronic
1083738654 11:64695936-64695958 CTTGGGAAGAAGGAGTCTGGTGG - Intronic
1084212888 11:67631967-67631989 CTTGGGAAGGAGGAGCAGGAAGG - Intronic
1084691831 11:70732081-70732103 CTGGGGCCACAGGAGTCTGATGG - Intronic
1085190242 11:74614372-74614394 TTGGGGATGGAGAAGTATGAAGG + Intronic
1085298747 11:75446023-75446045 CAGGGGAAGCAGGACTACAAAGG + Intronic
1085325592 11:75604098-75604120 GTGAGGAAGGAGAAGTATGAAGG - Intronic
1085524908 11:77158409-77158431 CTGGGCAACCTGCAGTATGAGGG + Exonic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1088300185 11:108349948-108349970 CTGGAGAGGAAGGAGTATGAGGG + Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089344922 11:117785031-117785053 CTGGGGAAGGAGGACACTGAAGG - Intronic
1090362274 11:126182012-126182034 CTGGGGAAGTCGGGGTATGGAGG + Intergenic
1090966433 11:131601267-131601289 CTGAGGCAGAAGGAGCATGATGG + Intronic
1091531977 12:1366783-1366805 CTGTGGATCCAGGAATATGATGG + Intronic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091807163 12:3365101-3365123 GTGGGGTGGCAGGAGAATGAGGG - Intergenic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1091880940 12:3977719-3977741 CTGAGGAAGCAGGAGAAACATGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095962854 12:47846280-47846302 CTGGGGAGCGGGGAGTATGAAGG - Intronic
1096851675 12:54442898-54442920 CCGGAGAAGCAAGAGAATGAAGG + Intergenic
1097314492 12:58157466-58157488 CTGAGGCAGCTGGAGTTTGAGGG - Intergenic
1097807434 12:63981184-63981206 CTAGGGAATCATGAGAATGATGG - Intronic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098541154 12:71659231-71659253 CTCTGGCAGCAGCAGTATGAAGG - Intronic
1098567169 12:71949993-71950015 TCGGGGAAGCAGGAGACTGAAGG - Intronic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1099570301 12:84309221-84309243 CTGGGTAAGAAGGAGAATAATGG + Intergenic
1101065774 12:101018830-101018852 GTGGGGAAGCAAGAGCATCAAGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1102894067 12:116584542-116584564 AGGGGGAAGCAGGAGCAAGAAGG - Intergenic
1103477902 12:121232236-121232258 CTGTGCAAGCAGGAGGATGCGGG - Intronic
1103548144 12:121716198-121716220 CTAGGGAGGCTGGAGTAGGAGGG + Intronic
1103912900 12:124362075-124362097 CTGGGGCAGCAGGGGACTGACGG - Intronic
1104039996 12:125123485-125123507 CTGGGGAAGTAAGAGAACGAAGG + Intronic
1104456019 12:128913132-128913154 GGGAGGAAGGAGGAGTATGAAGG - Intronic
1104931242 12:132340553-132340575 CTCGGGAAGCAGGAGCACCACGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1108191958 13:47950781-47950803 CTGGGGCAGCAGGAGCCTCAGGG + Intronic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1109994319 13:70103420-70103442 GTGGGGAAAAAGGAGAATGAGGG + Intronic
1110362832 13:74646886-74646908 CTGGGAAAGCAGGTGTAAAATGG - Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1111060781 13:83016136-83016158 CTGGTGAGGCAGGAGTACAATGG + Intergenic
1111102772 13:83609565-83609587 CAGGATTAGCAGGAGTATGAGGG + Intergenic
1112003898 13:95237717-95237739 GTGGGGGAGCAGGAGCATGGAGG - Intronic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1114266429 14:21075018-21075040 CTGGTTAAGGAGGAATATGAAGG + Exonic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115966034 14:38889279-38889301 CTGGGGGACCAGGTGAATGATGG + Intergenic
1117293339 14:54354562-54354584 CTGGGGAAGGAGCAGTGTGCTGG - Intergenic
1120242582 14:81966520-81966542 CAGGAGAAGAAGGAGTATCAGGG - Intergenic
1120325952 14:83026345-83026367 CTGGGGAAGCAGCCGTGTTAGGG + Intergenic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1121271531 14:92641249-92641271 CTGGGGTAGCCGCAGTGTGAAGG - Exonic
1121463171 14:94097631-94097653 CTGGAGCTGCAGAAGTATGAGGG + Intronic
1121598135 14:95181519-95181541 CAAGGGCAGCAGGAGTAAGATGG - Intergenic
1121644007 14:95505267-95505289 CTGGGGAAGGTGGAGCAAGAGGG + Intergenic
1122091136 14:99341322-99341344 CTGGGGAAGGACGAGGAAGAAGG + Intergenic
1122774571 14:104111560-104111582 CTGGGGCAGCCGGGCTATGACGG + Exonic
1123800632 15:23816214-23816236 CTGGGTAATGAGGAGCATGAGGG + Intergenic
1123861876 15:24477091-24477113 GTGAGGAAGCAGGAGCAGGAAGG + Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1127754727 15:62081067-62081089 CTGGGGAAGCATGGGTTTCAGGG - Intergenic
1127908404 15:63394963-63394985 CTGGGCAACTAGGAGGATGATGG - Intergenic
1128982580 15:72197914-72197936 CTGGGGAAGCTGGGGAATGAGGG - Intergenic
1129711912 15:77824750-77824772 CCAGGGAAGCAGGACTATGTGGG + Intergenic
1130437750 15:83918981-83919003 GTGGGTAAGCAGGAGTGTGATGG + Intronic
1131327208 15:91459487-91459509 CTGGGGAAGCTGGAAGCTGAGGG - Intergenic
1131511128 15:93050115-93050137 CTGGGGCAGCAGGATGTTGAAGG - Intronic
1132026280 15:98406870-98406892 CTGGGGTAGGAGGAGAAGGAAGG - Intergenic
1133258699 16:4534644-4534666 CTGGGGAAGCAGGAGGAAATGGG - Intronic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134250864 16:12572775-12572797 CTGGGGAAGGAGGAGTGAGGTGG - Exonic
1135425100 16:22328515-22328537 CCGGGGAAGCAGCAGTCTGGGGG - Exonic
1136544537 16:30948055-30948077 CTGGGGGAGCCGGGGTGTGAGGG + Exonic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1138416414 16:56874060-56874082 CTGGGGAACCATGACTCTGATGG - Intronic
1139851018 16:69951660-69951682 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1139880000 16:70174572-70174594 CTGGGGAGGAAGGAGGAGGAAGG + Intronic
1140372514 16:74420955-74420977 CTGGGGAGGAAGGAGGAGGAAGG - Intronic
1140449986 16:75063187-75063209 CTGGGGAAGCGGGGCTATGTGGG - Intronic
1140806005 16:78532949-78532971 CTGATGAAGCAAGAGTAGGAGGG + Intronic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1143057242 17:4171517-4171539 ATGAGGAAGCAGGCCTATGAGGG + Intronic
1143490626 17:7283503-7283525 CTGGGGAGGCAGGGGCCTGAGGG + Exonic
1143975132 17:10823925-10823947 TTGGGGAAGGAGAAGCATGATGG - Exonic
1144610376 17:16706893-16706915 CTGGGGAAAGATGAGGATGAGGG + Intronic
1144625929 17:16844474-16844496 AGGGGCAAGCAGGAGTCTGAAGG + Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144880504 17:18428246-18428268 AGGGGCAAGCAGGAGTCTGAAGG - Intergenic
1144902366 17:18608522-18608544 CTGGGGAAAGATGAGGATGAGGG - Intergenic
1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145130132 17:20337581-20337603 CTGGGGAAAGATGAGGATGAGGG + Intergenic
1145151731 17:20516141-20516163 AGGGGCAAGCAGGAGTCTGAAGG + Intergenic
1146163102 17:30570422-30570444 AGGGGCAAGCAGGAGTCTGAAGG + Intergenic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1147319351 17:39636643-39636665 CAGGGGAAGCAGGAGGAAAAGGG + Intergenic
1147878950 17:43641820-43641842 CTGGGGAAGGAAGAGGGTGAAGG + Exonic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1149324825 17:55519330-55519352 CTGGGTAAGGAGGGATATGAGGG + Intergenic
1149972003 17:61228076-61228098 AGGGTGAAGCAGGAGTATGCAGG - Intronic
1150266283 17:63834320-63834342 CTGGGGAGGCTGGAGTTGGATGG + Exonic
1151329238 17:73397118-73397140 CTGGGGAAGCAGGGTCAAGAGGG + Intronic
1151357848 17:73571022-73571044 CTGGGCCAGCAGGAGTTTGCTGG + Intronic
1151386852 17:73760258-73760280 CTGGGGAGGCAGGTGGATGCTGG + Intergenic
1151561434 17:74871993-74872015 CTGGAGCAGCAGGTGAATGATGG + Intronic
1152167083 17:78716729-78716751 CCGGGGCAGCATGAGAATGAAGG - Intronic
1152663050 17:81551880-81551902 CGGGGGCAGCAGGAGTGTGCGGG + Intronic
1155052168 18:22158035-22158057 CTTGGGAAGCAGGTGCTTGAGGG - Intergenic
1155171319 18:23268662-23268684 CTGGGGCAGCAGGACTAGGATGG + Intronic
1157517287 18:48320139-48320161 CTGGAGAAGAAGGAGAAGGAGGG + Intronic
1158523022 18:58187412-58187434 CCGGGGAAGAAGGAGTAAGAAGG + Intronic
1159443239 18:68508390-68508412 CCTGGGAAGCAGGAATATGCAGG + Intergenic
1159936897 18:74376192-74376214 ATGGGCAAGCAGGTGGATGATGG + Intergenic
1160273589 18:77409753-77409775 GTGTGGAAGCAGGTGTATGATGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1163111907 19:15166439-15166461 CAGTGGGTGCAGGAGTATGAAGG - Intronic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163361632 19:16850619-16850641 CAGGGGAAGGCGGAGTACGATGG + Intronic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1164845378 19:31427977-31427999 CTGGGGAAGTAGGAAACTGATGG + Intergenic
1164897593 19:31890812-31890834 CTGGGCAAGAAGGGGTGTGAGGG + Intergenic
1165255880 19:34577032-34577054 CTGGGGAAGGAGGGATAGGATGG + Intergenic
1166303208 19:41923680-41923702 CTGGGGAGGCAGGGGTGTGCTGG + Intronic
1166303269 19:41923841-41923863 CTGGGGAGGCAGGGGTGTGCTGG + Intronic
1166360329 19:42250457-42250479 CTGCGGAAGGAGGAGTACCAGGG - Exonic
1166656826 19:44618376-44618398 CAGGGGACACAGGAGTGTGACGG + Intronic
1168723625 19:58569167-58569189 TTGGGGATGCTGGAGTAAGAGGG + Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925271213 2:2608819-2608841 CTGGGGACCCAGGAGAATGGCGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926696071 2:15770935-15770957 CTGGGGCAGCAGCAGCCTGAAGG + Intergenic
927241439 2:20923024-20923046 CTGGGGATGGAGGAGTCTGCTGG - Intergenic
927881690 2:26693595-26693617 CTGGGGAGGCATGAGGATGTCGG + Intronic
929780758 2:44955484-44955506 GCGGGGAGGCAGGAGTATGGTGG + Intergenic
929789359 2:45012207-45012229 ATGGGGGAGGAGGAGAATGAGGG - Intergenic
929852204 2:45602736-45602758 CTGGGTTGGCAGGAGCATGATGG - Intronic
930126086 2:47797993-47798015 CAGGGAAAGCAGCATTATGAAGG - Intronic
930196123 2:48512205-48512227 CTGGGCAAGCAGAAGGATTATGG - Intronic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932777730 2:74538367-74538389 CTGGGGAATGAGGGCTATGAGGG + Intronic
933633347 2:84680907-84680929 ATGGGGAAGCTGAAGTGTGAGGG + Intronic
934818957 2:97355366-97355388 CAAGGGAAGCAGATGTATGAGGG + Intergenic
936601225 2:113896892-113896914 TTGGGGGAGCAGGAGCATGCTGG - Intronic
936642020 2:114323989-114324011 TTTGGGAACCAGGAGTATTAAGG + Intergenic
936649283 2:114407760-114407782 CTGTGGATGAAGGATTATGAAGG - Intergenic
940987383 2:160062669-160062691 TTGGGGAAGGAGGAGGAGGAGGG + Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943511907 2:188836513-188836535 CTGGGGAAGAAGGAGTACACTGG - Intergenic
944865695 2:203859283-203859305 CTGGGGAAGATGGTGAATGATGG + Intergenic
945691017 2:213035875-213035897 ATTGGGAAGCAGGAGTATAGTGG + Intronic
946085041 2:217162433-217162455 AAAGGGAAGCAGGAGGATGAAGG + Intergenic
946087300 2:217186906-217186928 CTGGGGAAGCTGGAGGAAGCAGG - Intergenic
946285182 2:218697397-218697419 GTGGGGAAGCAGGGGTATCTGGG + Intronic
946818933 2:223610445-223610467 GTGGGAATGCAGAAGTATGAGGG - Intergenic
947597955 2:231425863-231425885 CTGGGGAAGCACCAGCCTGAGGG + Intergenic
947911190 2:233802060-233802082 CTGGGGAAGCAGGGATGGGATGG + Intronic
948457656 2:238114330-238114352 CGGGGTCTGCAGGAGTATGAGGG - Intronic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
1170012165 20:11736084-11736106 CTTGGGAAGCAGGTGGAAGAGGG - Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171971484 20:31567672-31567694 GTGGGGTAGCTGGAGCATGAGGG - Intronic
1172247963 20:33458922-33458944 TTGCCGAGGCAGGAGTATGATGG + Intergenic
1173476519 20:43363695-43363717 CGCGGGAAGTAGGAGTGTGAAGG + Intergenic
1173743471 20:45419046-45419068 CTGAGGAAGCAGGAAACTGAGGG - Intronic
1175886025 20:62291417-62291439 CTGCGGGTGCAGGAGTCTGAAGG - Intronic
1177138665 21:17334104-17334126 ATGGGAAAGCGGGGGTATGAGGG - Intergenic
1177268293 21:18811821-18811843 CAGGTGAAGCAGGTTTATGAGGG + Intergenic
1178820036 21:35966668-35966690 CTGGGGAAGCAGGAGTATGAGGG + Intronic
1179403091 21:41102415-41102437 CTGGGGAAGCAGGACGAAGCTGG + Intergenic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180729765 22:17972644-17972666 TTGGGGCAGCAGGAGAAGGAAGG + Intronic
1181618004 22:24068188-24068210 TTGGGGAAGCAGGAGGGAGAAGG + Intronic
1182100550 22:27654725-27654747 CTGGGGAAGCAGGCGACAGAGGG - Intergenic
1182236655 22:28882203-28882225 CTGGGAAAGCAGGACTCTGGAGG - Intergenic
1182350034 22:29694226-29694248 CTGGGAAACCAGGAGTAGAAGGG + Intronic
1183460026 22:37944260-37944282 CAGGGAAAGCAGGTGTATCAGGG + Intronic
1183524199 22:38314173-38314195 CAGAGGAAGCAGGAACATGAGGG + Intronic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183672350 22:39280396-39280418 CTGGGTAGGCAGGAGTGTGGTGG - Intergenic
1183820029 22:40338697-40338719 GTGTGGAAGCAGGAATTTGAGGG - Intergenic
1184927198 22:47651257-47651279 CTGGGGAAGGAGGAGAAGGTGGG + Intergenic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
951393970 3:22141663-22141685 CTGGGGGAGGAGGAGGAGGAGGG + Intronic
952199335 3:31110271-31110293 CAGGGTAAGCAGGGGTATGCTGG + Intergenic
952384463 3:32830028-32830050 CCGGGGAGGCAGGAGAATGCTGG - Intronic
952848779 3:37711058-37711080 CTGGGGATGCAGTTGTCTGAAGG + Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953535420 3:43773594-43773616 CTGGGGAAGCCAGCGTGTGACGG - Intergenic
953616245 3:44493217-44493239 ATGGGGGAGCAGGGGGATGATGG - Intergenic
953924632 3:46976363-46976385 CCCGGGAAGCAGGAGTCAGATGG + Intronic
954131221 3:48561969-48561991 CTGGGGATGCAGGGGTACGTGGG + Exonic
954369906 3:50164746-50164768 CTGTGGAAGCAGCATCATGAGGG + Intronic
954553850 3:51503370-51503392 CGGGAGAAGGAGGAGAATGAAGG - Intergenic
954583811 3:51717957-51717979 GTGGGGAAGCAGGGCTGTGAGGG - Intronic
954776815 3:53026838-53026860 CTGGAGAGGCTGGAGTAAGATGG + Intronic
956189931 3:66598709-66598731 GTGGGGAAGGAGGGGTGTGAAGG + Intergenic
960812148 3:121635669-121635691 CTGGGGAAGAAAAAGAATGAGGG + Intronic
960938268 3:122916630-122916652 CGTGGGAAGCAGAAGTGTGAGGG - Intronic
961346041 3:126263974-126263996 CTGGGGAAGCGGTAGGATGTTGG + Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
962152831 3:132911142-132911164 CCAGTGAAGCAGGAGTATGAAGG + Intergenic
962312913 3:134338562-134338584 CTGGGGCAGCAGGTGCATGTTGG - Intergenic
963322187 3:143821008-143821030 CTGGGGAAGCTGGACTGGGAAGG + Intronic
964317407 3:155458906-155458928 CTAGGGAAGCAAGAGTAAGGGGG - Intronic
965067130 3:163864339-163864361 ATGGGGATCCAGGAGGATGAGGG - Intergenic
966141121 3:176757393-176757415 CTGGTGAAGCCGGAGTAGAATGG + Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
967232063 3:187348742-187348764 CTGGGGCAGCAGGAGTGGGGTGG + Intergenic
968460252 4:721191-721213 CTGGGGAACCATGAGAATCAGGG - Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968853674 4:3102235-3102257 CTGCGGAAGCAGGGGCAAGAGGG + Intronic
968877475 4:3280601-3280623 CTGGGAGAGAAGGAGAATGAGGG + Intergenic
969054840 4:4395195-4395217 CTGGGGAAGCAGCACTTTGGAGG - Intronic
970107832 4:12605009-12605031 ATAGGGAAGCAGGAGAAGGAAGG - Intergenic
970346878 4:15160799-15160821 CTGAGGATGGAGGAGAATGAGGG + Intergenic
971327826 4:25658512-25658534 CTTGGGAAGCAGGGGAATGTAGG - Intronic
972629653 4:40832449-40832471 GTGAGGAAGCAGGAGTAGGTTGG - Intronic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973197170 4:47458713-47458735 CTGAAGAAGCATGAGAATGAAGG + Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973882820 4:55291002-55291024 TTGGGGAAGCATCACTATGAAGG - Intergenic
974132809 4:57777457-57777479 CTGGGAAAGAAGGAGGCTGAGGG - Intergenic
974438596 4:61888081-61888103 TTTGGGAAGCAAGATTATGAGGG + Intronic
975535931 4:75450405-75450427 ATGGGGAAGCAGGGGTAGAACGG + Intergenic
975798958 4:78038676-78038698 CTGGGAAAGGTGGAGTAAGAAGG + Intergenic
978217327 4:106220353-106220375 CTGGGGAAGCCCCAGAATGATGG - Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
979817102 4:125122641-125122663 TTGGGGATGCAGGAAGATGAAGG + Intergenic
980869007 4:138589189-138589211 CTGGGGAAGAAGGAGTTCTAAGG - Intergenic
981198085 4:141943576-141943598 CTGGGGAGTGAGGACTATGATGG - Intergenic
982116616 4:152103731-152103753 CTGGGGCAGGAGGAGGAGGAGGG - Intergenic
983431384 4:167655925-167655947 CTGGTGAAGCGGGTTTATGAGGG - Intergenic
983599202 4:169505316-169505338 CTGAGGAAGGAGGAGTAAGAGGG - Intronic
984551750 4:181169028-181169050 CTGGGGTAGAAGGAGGGTGAAGG - Intergenic
984967067 4:185148921-185148943 CTGGGGAGGCAGGAGTGAGTCGG - Exonic
988612412 5:32739372-32739394 TTGGGGGAGAAGGAGGATGAAGG + Intronic
988617792 5:32792466-32792488 CTGGGGAGGTAGGAATATGGTGG - Intergenic
988639245 5:33023066-33023088 CTGGAGAAGCTGGGGTATGTAGG - Intergenic
990198266 5:53342998-53343020 CTGGGGAAGCCTCAGTATCATGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991386940 5:66101124-66101146 TTGTGTAACCAGGAGTATGATGG - Intergenic
992948963 5:81837951-81837973 CTAGGGAAGCGGGAGCAGGAGGG + Intergenic
994878522 5:105456116-105456138 TTTGGGAATCAGGAGTAGGAAGG - Intergenic
995005125 5:107183114-107183136 TTGGGCAAGGGGGAGTATGATGG + Intergenic
996248286 5:121293441-121293463 CTGTGGAAGCAGGAATGTCAAGG + Intergenic
996997594 5:129716755-129716777 CTGTGGGAGGAGGAGTATGCAGG - Intronic
997267535 5:132503950-132503972 CTGGGGAGACTGGAGTAGGAGGG + Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998565795 5:143214805-143214827 CTGGGTCAGCAGGAGTGGGAGGG + Intronic
998874289 5:146583797-146583819 CTGAGGAAGCTGGAGTAGAAGGG - Intronic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1001704905 5:173734612-173734634 CTGGGGAGGCAGGTGTGTGGGGG + Intergenic
1002366486 5:178716595-178716617 CTGGGGAAGGAGGGGGATGAAGG + Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1003080528 6:3017532-3017554 CTGGGGAAGCAGGCCTGGGAGGG - Intronic
1003402748 6:5804330-5804352 CTGGGGAAGCAGGTGCTTGCTGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003415129 6:5900205-5900227 CTAGGGAAGCAGGAGGAAGGAGG + Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1008616550 6:53232038-53232060 CTAGGGAAGGAGGAGAATAAAGG + Intergenic
1009357722 6:62772279-62772301 CTGGGGATGGAGGAGAGTGAAGG - Intergenic
1010364665 6:75035423-75035445 CTGGAAAAGCAGGAGAATGCTGG + Intergenic
1010473018 6:76252097-76252119 CTGGGGCAGCAGGAGTGAGGAGG + Intergenic
1010806587 6:80244191-80244213 CTGGTGAAGCAGGAGATGGAAGG + Intronic
1011287806 6:85743763-85743785 ATGGTGGAGCAGGAGAATGAAGG - Intergenic
1012562676 6:100603619-100603641 GTTAGCAAGCAGGAGTATGAGGG - Intronic
1014258116 6:119184572-119184594 CTGAGGAGGCAGGAGTAGGAAGG + Intronic
1014730095 6:125022426-125022448 CTGGGGAAGTTGGACTAGGAAGG + Intronic
1015678823 6:135781380-135781402 CTGGGGAAGCTGCAGTGGGAAGG - Intergenic
1016304136 6:142665835-142665857 GTGGGGGAGCAGGAGAGTGAGGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017094748 6:150794747-150794769 ATGGGGAAGCAGGGGAATGGGGG + Intronic
1018212971 6:161499964-161499986 GTGGGGAAGGAGGAGAGTGAGGG - Intronic
1018634638 6:165849985-165850007 TTGGGGAAGCGGGAAAATGATGG - Intronic
1019212421 6:170417383-170417405 GTGGGGAAGGAGGGGTAGGAAGG - Intergenic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020149251 7:5668794-5668816 CTTGTGAACCAGGAGAATGAAGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021588542 7:22236555-22236577 CAGGGGAAGGAGGACCATGAAGG - Intronic
1023507126 7:40911458-40911480 CTGGGGAGGCTGAAGTAGGAGGG + Intergenic
1025977508 7:66380442-66380464 CTCGGGAAGCTGAAGTAGGAGGG + Intronic
1026191930 7:68136553-68136575 GAGGGGAAGGAGGAGGATGAGGG + Intergenic
1026548081 7:71341931-71341953 CTGTGGATGCAGGAGGATGCAGG + Intronic
1026554265 7:71392261-71392283 CTGGGGAAGTAAGAATGTGAAGG + Intronic
1027184874 7:75965075-75965097 CTGGGGAAGCCTGTGTAGGATGG + Intronic
1027468363 7:78542654-78542676 CTGGGAAAGAAGGAGCATGTAGG + Intronic
1028705475 7:93839915-93839937 TTGGGGAAGGAGGATCATGAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030343739 7:108409631-108409653 TTGGGGGAGGAGGAGCATGATGG + Intronic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031630201 7:124034481-124034503 CGGGGGAAGGAGGAGAAAGAGGG - Intergenic
1032794764 7:135268769-135268791 ATGGGGAGGCAGGGCTATGAAGG - Intergenic
1033195228 7:139321782-139321804 CTGGGGAAGCAGGGGAAGGAAGG - Intergenic
1033444913 7:141412066-141412088 TTGGGGATACAGGACTATGAAGG - Intronic
1033450971 7:141462254-141462276 CTAGGGAAGCAAGACTTTGAAGG + Intronic
1034926980 7:155130333-155130355 CTGAGGCAGCTGGAGCATGATGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035241891 7:157537705-157537727 CTGGGGATGGTGGAGGATGAGGG - Intergenic
1035318113 7:158010120-158010142 CTGGGGATGCCGGAGTAAGCAGG - Intronic
1035524463 8:301341-301363 CTGGGGAAGGAAGAGCAAGAAGG + Intergenic
1035528724 8:334962-334984 ATGGGGCAGCAGGAGTGTGTTGG + Intergenic
1035704428 8:1664316-1664338 CCTGGGAAGCAGGAGTAGGACGG - Intronic
1036653774 8:10662577-10662599 CAGGGGAAGCGGGAGGGTGATGG - Intronic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1039802848 8:40974965-40974987 CTGGGGTAGGAGGAATCTGATGG + Intergenic
1041421021 8:57667046-57667068 CTGGGGAAGCATGAGCCTGTGGG - Intergenic
1041988350 8:63954307-63954329 TTGTGGAAGCGGGAGCATGAAGG + Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1044506314 8:93024204-93024226 GTGGGGAAGCAGGAGTAGGCAGG + Intergenic
1044740457 8:95321244-95321266 CAGGGGAAGCAGGTGTTAGAAGG - Intergenic
1047291180 8:123531740-123531762 TTGGGGAAGAAGGAGATTGAGGG + Intronic
1047650748 8:126917530-126917552 CTTGTGAAGCAGAAGTCTGATGG - Intergenic
1048205845 8:132414591-132414613 CTGGGGAGGAAGGGGAATGAGGG + Intronic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048545169 8:135379832-135379854 CTGGGGCAGGAAGGGTATGATGG + Intergenic
1048853728 8:138669047-138669069 CCAGGGAAGCTGGAGTCTGAAGG + Intronic
1049171137 8:141161400-141161422 CTGGGGAAGCAATAGCATGCAGG - Intronic
1049223990 8:141440998-141441020 GTGGGAAGGCAGGAGTACGAGGG + Intergenic
1049287536 8:141783947-141783969 TTGGGGAGGCAGGAACATGAGGG - Intergenic
1049719071 8:144107289-144107311 CATGGGCAGCAGGAGTCTGAGGG - Exonic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1055078010 9:72237106-72237128 CAGGTGGAGCAGGAGCATGAGGG - Intronic
1056187232 9:84147396-84147418 CTGGGGAAGGATGACTGTGAGGG - Intergenic
1056819534 9:89828565-89828587 CTGGGGAAGCTTGAGTAAGTGGG + Intergenic
1058144969 9:101400420-101400442 ATGGGGAAGGAGGAGGATGTGGG - Intronic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1058668717 9:107342860-107342882 CTGGGGAAGAAGGAATATCTGGG - Intergenic
1058781087 9:108336209-108336231 CAGGGGAAGCAGGACTAAAAGGG - Intergenic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059528512 9:115015189-115015211 CTAGGGAGGGAGGAGGATGAGGG + Intergenic
1060235119 9:121857273-121857295 CTGGTGAAGCAGGAGTCAGAGGG - Intronic
1060978186 9:127777504-127777526 CTGGGGCAGCAGGGGGATGGGGG - Intronic
1062529911 9:136995284-136995306 CTGGGGAAGCTGCGGGATGAGGG + Exonic
1185913793 X:4011651-4011673 ATGGGGAAGGAGGAGCAGGAAGG - Intergenic
1186756987 X:12681953-12681975 CTGGGGGTGGAGGAGAATGAGGG - Intronic
1187558299 X:20374197-20374219 CTGGAAAGGCAGGAGTATGAAGG - Intergenic
1188983097 X:36745364-36745386 CTTGTGAAGCAGGAATATTATGG - Intergenic
1189058777 X:37729246-37729268 ATGGGGAGGCAGGAGTAAGATGG - Exonic
1189701683 X:43719675-43719697 TTGGGGAAGCGGGGGAATGATGG + Intronic
1190122285 X:47672172-47672194 AAGGGGAAGCATGAGTAGGAAGG - Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192265023 X:69531941-69531963 CTGAGGATGCAGGAGTTAGAAGG - Exonic
1192720084 X:73686005-73686027 CTTGTGAAGCAGGAATATTATGG - Intronic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195137117 X:101919756-101919778 CAGGGGAGGCAAGAGTATGAAGG + Intronic
1195674755 X:107499472-107499494 ATGGGGAAACAGGAATATTATGG - Intergenic
1195954070 X:110310286-110310308 CTGGGGAACCATGAGGATGGTGG - Intronic
1196942860 X:120794765-120794787 CTAGAGAAGCAGGGGTGTGAGGG - Intergenic
1197889951 X:131259630-131259652 CTGGGGAACAAGGAGTGAGAGGG - Intergenic
1198373672 X:136016263-136016285 TTGGGGGAGCTGGAGGATGAGGG + Intronic
1201237794 Y:11928305-11928327 CTGGGGAGGCCTCAGTATGATGG - Intergenic