ID: 1178820772

View in Genome Browser
Species Human (GRCh38)
Location 21:35973118-35973140
Sequence CAGGCTAAGGATTCAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178820768_1178820772 -6 Left 1178820768 21:35973101-35973123 CCTGGGCTCCTGGGATTCAGGCT 0: 1
1: 0
2: 4
3: 34
4: 377
Right 1178820772 21:35973118-35973140 CAGGCTAAGGATTCAGCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178820772 Original CRISPR CAGGCTAAGGATTCAGCACA GGG Intronic
901165598 1:7219621-7219643 GGGGTTAAGGCTTCAGCACATGG - Intronic
901364518 1:8734508-8734530 CAGGCTCATGAGGCAGCACAAGG + Intronic
902094274 1:13929819-13929841 CACGCAAAGCATTTAGCACAAGG - Intergenic
902325483 1:15697408-15697430 CTGGCTGAGAACTCAGCACAGGG - Intronic
902652610 1:17846297-17846319 CAGGTTGAGGACACAGCACATGG - Intergenic
902827269 1:18985189-18985211 CAAGCTATGGAGTCTGCACATGG - Intergenic
903983775 1:27209633-27209655 CTGGCAAAGGATTCAGCGCCTGG + Intergenic
904086448 1:27912763-27912785 CAGGCTATGGAGCCAGAACATGG - Intronic
915148149 1:153807720-153807742 CAGGGAAAGGACTCAGCTCAGGG + Exonic
915153308 1:153853017-153853039 GGGGCCAAGGATTCATCACAGGG - Intronic
918186262 1:182130154-182130176 CTGGCTAAGCAGTCAGCAAACGG + Intergenic
920841995 1:209562896-209562918 CAGGCAGAGGAGGCAGCACATGG + Intergenic
921158697 1:212457821-212457843 CAGGCTCAGGCTTCAGCTCCTGG + Intergenic
921192313 1:212721673-212721695 CTGGCTTAGGATTCTGCTCATGG + Intergenic
1064141661 10:12795808-12795830 CAGGATAAGAACTCATCACATGG - Intronic
1065582419 10:27185114-27185136 AAGGATAAGGATGGAGCACAGGG + Intronic
1065968728 10:30789051-30789073 CAGGCTTGGGACCCAGCACAGGG - Intergenic
1066132828 10:32410566-32410588 CTGGGCAAGGATTCAGCACTAGG + Intergenic
1070403849 10:76077133-76077155 TAGGCTGAGGATGCAGCACCAGG + Intronic
1070480831 10:76881191-76881213 CGGGCTAAGGAGACAGCGCAGGG + Intronic
1071125400 10:82329005-82329027 CAGGCAAAGGATGCAGAAAATGG - Intronic
1071511855 10:86267019-86267041 CAGGCTGACCACTCAGCACAGGG + Intronic
1072128571 10:92469766-92469788 CATGCTAAGTACTTAGCACATGG - Intronic
1072799367 10:98382461-98382483 CATGATAAGCATTCAGTACATGG - Intergenic
1074195073 10:111176654-111176676 CATGCAAAGTATTTAGCACAGGG - Intergenic
1075199201 10:120388069-120388091 CAGGCTAAGGACTCAGTTCCTGG - Intergenic
1075632001 10:124006085-124006107 CTGGCTAAGGATTGAGCATTGGG - Intergenic
1076216369 10:128697068-128697090 CAGGCTAATGATTGTGAACAGGG - Intergenic
1082006863 11:47424180-47424202 CACCCTAAGGACACAGCACAGGG + Exonic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1083998637 11:66284282-66284304 CAGGCTGGGGATTCAGCTTAGGG - Intronic
1084858163 11:72001853-72001875 CAGGGTTAAGACTCAGCACAGGG + Exonic
1085128217 11:74016512-74016534 CAGGCCCAGGAATCAGAACAAGG + Intronic
1086404597 11:86488985-86489007 CAGGCTGAGAAGACAGCACAAGG + Intronic
1091513551 12:1154500-1154522 CAGGCGAAGGATTTATGACAAGG + Intronic
1093231724 12:16553100-16553122 CATGCTTAGCATTTAGCACATGG - Intronic
1094356305 12:29581696-29581718 CAGGCAAAAGGTTTAGCACAGGG + Intronic
1095568141 12:43650212-43650234 AAGGTTAAGGATGCAGCAAAGGG - Intergenic
1096087782 12:48877662-48877684 CAGGCAGAGCATTTAGCACACGG - Intergenic
1096323555 12:50637361-50637383 GAGGCTAAAGATACAGCAAAAGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1099448930 12:82785280-82785302 AGGGCTCAGGATTCAGCATAGGG - Intronic
1100806657 12:98292551-98292573 CAGACAATGGCTTCAGCACATGG - Intergenic
1101881828 12:108630901-108630923 CAGGCCCAGGATTCAGCCGATGG + Intronic
1102570408 12:113823865-113823887 CAGGCTAATGGTGCAGTACATGG + Intronic
1102807780 12:115797030-115797052 CTGGCTAAGAATTGAGGACAGGG + Intergenic
1105680158 13:22717881-22717903 CAAAATATGGATTCAGCACATGG - Intergenic
1106560576 13:30841950-30841972 CAGCCTAAGGTTTTAACACAAGG + Intergenic
1106624776 13:31409325-31409347 CATGCTGAGGATGCAGCATAGGG + Intergenic
1107206210 13:37791966-37791988 TAGCCAAAGGATTCAGGACAAGG + Intronic
1107437095 13:40389754-40389776 CAGGCTAAGGATGCAGGAACTGG - Intergenic
1107865995 13:44703879-44703901 CAGGTTAAGGAATAAGTACACGG + Intergenic
1108908692 13:55514527-55514549 CAGGCTTAGGAGTAAGCAGAGGG + Intergenic
1112925169 13:104665141-104665163 CAAGCTAAGAATTCAGGAAAAGG + Intergenic
1114568538 14:23649625-23649647 CAGGCCAAGTTTCCAGCACAGGG + Intergenic
1117847317 14:59924914-59924936 CAGGCAAAGGAAACAGCAAATGG - Intronic
1120161055 14:81144712-81144734 CATACTAAAGATTCAGCAAATGG + Exonic
1120242875 14:81970423-81970445 CATGCTGAGGTTTCAGCAAAAGG + Intergenic
1120637550 14:86970632-86970654 AAGATTAAGGATTCAGCATATGG - Intergenic
1122020059 14:98830418-98830440 CAGGGGAAGGAATCAGCACAGGG - Intergenic
1126519859 15:49580651-49580673 CAGGCAAAGAATTCAGAACATGG + Intronic
1127933103 15:63610684-63610706 CAGCCTCAGGAGGCAGCACAGGG + Intronic
1129898681 15:79128884-79128906 GAATCTAAGGATTCAGGACAAGG - Intergenic
1130555244 15:84918111-84918133 GAGGCCAAGGATTGAGCTCATGG + Intronic
1130973411 15:88753518-88753540 CATGCTAAGGTTTCATTACAAGG + Intergenic
1132489806 16:221362-221384 CAGTCCAAGGATTCAGTAAATGG + Intronic
1133176761 16:4021348-4021370 GAGGCTAAGGCTTCAGCGCAAGG - Intronic
1133254124 16:4506028-4506050 GAGGCTAATGATGCAGAACAGGG - Intronic
1136284501 16:29233208-29233230 GAGGCTGAGGATGCTGCACAGGG - Intergenic
1138035151 16:53596814-53596836 CAAGGTAAGGATTGAGCATAAGG - Intergenic
1138216165 16:55207210-55207232 CAGGCCAAGGATCCAGCCTAAGG + Intergenic
1139281617 16:65775394-65775416 CAGGCCAAGTGTTCTGCACATGG - Intergenic
1139320009 16:66106741-66106763 CAGGGAAAGGATTTAACACAGGG - Intergenic
1140087168 16:71807898-71807920 AAAGCTAAGTATTCAGCACAGGG + Intronic
1141374816 16:83520818-83520840 CAGGCACAGGATCCACCACATGG + Intronic
1142089537 16:88202721-88202743 GAGGCTGAGGATGCAGCACACGG - Intergenic
1150528258 17:65947391-65947413 CAGTCAAAGGATTCAACAGACGG - Intronic
1151418064 17:73979700-73979722 CAGGCTAATGATAGAGAACAGGG + Intergenic
1153809277 18:8737674-8737696 CAGGCTAAGGATAGAGCACTGGG + Intronic
1155152550 18:23134870-23134892 CAGGCCAAGGATGCAGCCCCCGG - Intronic
1157984255 18:52419228-52419250 CATGTTCAGGATGCAGCACAGGG + Intronic
1159114419 18:64097503-64097525 CAGTCCAAGGTTTGAGCACAAGG + Intergenic
1159633208 18:70773819-70773841 CAGGATAGGGATGCAGCAGAAGG + Intergenic
1162305106 19:9867771-9867793 AAAGCTAAGAATTCAGCCCATGG + Intronic
1164104458 19:22095075-22095097 CAGCTTAAGGGTTAAGCACACGG - Intergenic
1165399918 19:35592321-35592343 CAGACTGAGGATAAAGCACAGGG + Intergenic
1165609474 19:37138133-37138155 CAGACTAAGGATTCAGTAAAAGG + Intronic
1166277564 19:41765267-41765289 CAGGTAAAGTATTTAGCACAGGG + Intronic
1166430758 19:42724933-42724955 CAGGGAAAGTATTTAGCACAGGG - Intronic
1166443780 19:42840280-42840302 CAGGTAAAGTATTGAGCACAGGG - Intronic
1166451220 19:42902962-42902984 CAGGTAAAGTATTGAGCACAGGG - Intronic
1166463467 19:43010959-43010981 CAGGTAAAGTATTTAGCACAGGG - Intronic
1166480752 19:43171042-43171064 CAGGTAAAGTATTTAGCACAGGG - Intronic
1166490332 19:43254160-43254182 CAGGTAAAGTATTGAGCACAGGG - Intronic
1167755873 19:51413353-51413375 CATCCTAGGGATTCAGCACAGGG - Intronic
929026986 2:37614377-37614399 CTGGCTAAGGATGCACCATAGGG + Intergenic
932136009 2:69229156-69229178 GAGGCTGAGGCTTCAACACATGG + Intronic
933025307 2:77250672-77250694 AAGGCAAAGGCTTAAGCACATGG + Intronic
933882635 2:86685793-86685815 CAGACAAAGAATTTAGCACAAGG - Intronic
936151931 2:110026729-110026751 CAGTCTCAGGTCTCAGCACAGGG - Intergenic
936192746 2:110344684-110344706 CAGTCTCAGGTCTCAGCACAGGG + Intergenic
937889679 2:126928076-126928098 CAATCTAAGGATGCACCACAAGG - Intergenic
944708787 2:202317123-202317145 CAGGCTAAGAAATCACCGCATGG + Intergenic
946595969 2:221306435-221306457 CAGGGCAAGGTTTCAGCAAAAGG - Intergenic
948604043 2:239123516-239123538 CAGGCTCAGGATTGAGGAGATGG - Intronic
948735170 2:239998980-239999002 CAGGCTCAGGATGCTGCACCAGG + Intronic
1169085135 20:2821505-2821527 CAGGCTAAGACTCCAGCACTCGG + Intergenic
1172630399 20:36374590-36374612 CAGGCTATGCTTCCAGCACAAGG - Intronic
1173142252 20:40494596-40494618 CCAGCTGAGGATGCAGCACAGGG - Intergenic
1174507489 20:51025945-51025967 CAGGGTAAGGATGCAGAGCAGGG + Intergenic
1178476874 21:32944749-32944771 CAGGCTAAGCAGTGAGAACATGG + Intergenic
1178820772 21:35973118-35973140 CAGGCTAAGGATTCAGCACAGGG + Intronic
1179058089 21:37954431-37954453 CAGGAAAAGGACTTAGCACAGGG + Intronic
1183202612 22:36396241-36396263 CCTGCGAAGGCTTCAGCACAGGG + Intergenic
1183284530 22:36953661-36953683 CAGGCTAAGTCCCCAGCACAGGG + Intergenic
1184667903 22:45998139-45998161 CAGGCTCAGGGCTCAGCTCAGGG - Intergenic
949893361 3:8749732-8749754 AAGTCTAAGGATTTAGCACAAGG - Intronic
950611972 3:14132678-14132700 CATGGGAAGGATTCAGCACCAGG + Intronic
951075229 3:18383133-18383155 CAGGCAGAGGATGAAGCACAGGG + Intronic
951779613 3:26347600-26347622 CAGGCCAGGCATCCAGCACAAGG - Intergenic
954789316 3:53119495-53119517 CAGGTAAAGCATTCAGCATAGGG + Intronic
955332442 3:58058604-58058626 CTGGCTAAGGATTGTGCAAAAGG + Intronic
957662731 3:83182636-83182658 CAGGCAAAGGCTTCATGACAAGG + Intergenic
959225327 3:103574614-103574636 CAGGGTGGGGATTCAGAACATGG + Intergenic
961633311 3:128317445-128317467 CATGCTCAGGGATCAGCACAAGG + Intronic
961981964 3:131089114-131089136 CAGGCTAAATATTAAGTACATGG + Intronic
963311052 3:143710423-143710445 CAGGCCAAGTAACCAGCACAAGG + Intronic
967235336 3:187378567-187378589 CAGACTAAGGAATCAGCAAGGGG + Intergenic
969001946 4:3989521-3989543 CTGGCTAGGGCTTCACCACAGGG - Intergenic
969058675 4:4417970-4417992 CCGACTCAGGAGTCAGCACAGGG - Exonic
971967933 4:33586106-33586128 CATGCTAAGCATTGAGCACAGGG - Intergenic
974386963 4:61213825-61213847 CAGGCCAAGCTTTCAGCACTCGG - Intronic
975411620 4:74058612-74058634 GATGATAAGGATTCTGCACAGGG + Intergenic
978390034 4:108215680-108215702 CAGGTGGAGGATGCAGCACATGG + Intergenic
979747668 4:124238022-124238044 CATGCTTAGCACTCAGCACAAGG - Intergenic
981558934 4:146026069-146026091 GAGGGGAAGAATTCAGCACATGG - Intergenic
984265050 4:177488290-177488312 CACCCTAAGTATTTAGCACATGG - Intergenic
989676069 5:43974302-43974324 CATACTAGGGATTTAGCACACGG - Intergenic
992475983 5:77102122-77102144 CACGATATGGATTCTGCACATGG - Intergenic
993440966 5:87956425-87956447 CAGGATAAGGAGTCAGGAAATGG - Intergenic
996981239 5:129497799-129497821 TAGGCTAAGGAGGCAACACAGGG - Intronic
997617036 5:135253972-135253994 CAGACTCAGGAAGCAGCACATGG + Intronic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
998322415 5:141245335-141245357 CAGGCTAAGGCTTCAAAAAAAGG + Intergenic
998418098 5:141959905-141959927 TGGGGTAAGGACTCAGCACAGGG + Intronic
999122946 5:149223906-149223928 CATGGTAAAGACTCAGCACAGGG + Intronic
1000332489 5:160216809-160216831 CATGCTAAGCACTCAACACATGG - Intronic
1000875718 5:166635571-166635593 CAGCCTAAGAATTTAGAACAAGG + Intergenic
1001233190 5:170007677-170007699 CAGGTAAAGGGGTCAGCACATGG - Intronic
1004276631 6:14242294-14242316 CATGTTAAGGATACAGCAAAGGG - Intergenic
1004510334 6:16279322-16279344 CAAGCTAAGGAACCAGCAGAAGG - Intronic
1008366317 6:50684826-50684848 CAGGCTAAGAAATCATCAGAAGG - Intergenic
1011962326 6:93106425-93106447 CAGGGTAAGGAGTCAGCAGATGG - Intergenic
1013833394 6:114301650-114301672 CAGGTCAAGGATTCAGCCCCAGG - Intronic
1014288664 6:119533268-119533290 CAGGCTGGGGATCCAGGACAAGG - Intergenic
1019559463 7:1648745-1648767 CGGGCTGAGGATTCAGGAGAAGG - Intergenic
1022030363 7:26487050-26487072 CACACTAAGCATTCAGCAAATGG + Intergenic
1033939471 7:146634273-146634295 CTGACTGAGGATTCGGCACAGGG - Intronic
1036219607 8:6910391-6910413 CAGGCTAAGCCATCAGCACAAGG - Intergenic
1038102327 8:24391948-24391970 CAGGTTATGGATTAAGAACAGGG - Intronic
1040563636 8:48546454-48546476 CAGCCCTAGCATTCAGCACAGGG + Intergenic
1042511255 8:69614137-69614159 CACGGTAAGAACTCAGCACATGG - Intronic
1043567117 8:81560829-81560851 CAGCCTAAGGATTAAGAGCATGG - Intergenic
1047914558 8:129568050-129568072 CAAGCCAAGGTTTCAGCACCAGG - Intergenic
1050492012 9:6198055-6198077 GCAGCTAAGGATTCAGTACAGGG - Intergenic
1050702977 9:8362030-8362052 CAGGCAAAGAATTCAGCAAGAGG + Intronic
1051105071 9:13569960-13569982 GAAGTTAAGTATTCAGCACAAGG + Intergenic
1052272478 9:26641051-26641073 CAGGTGAGGGAGTCAGCACAGGG + Intergenic
1054842239 9:69755570-69755592 CAGTCCAAGGATTCAGGAAATGG + Intronic
1055556334 9:77477397-77477419 AGGGCTCAGGATTCAGTACATGG - Intronic
1055734124 9:79309654-79309676 AAGGCCAAGGATTGAGAACAAGG + Intergenic
1059378803 9:113907529-113907551 TTGGATAAGGATTCAGCAAAAGG - Intronic
1059473626 9:114526167-114526189 AAGGATCAGGACTCAGCACAAGG - Intergenic
1062572419 9:137191775-137191797 CAGGCTGAGGAGACAGGACAGGG + Exonic
1190498017 X:51045713-51045735 CAGGGAAGGGATTCAGCACTGGG + Intergenic
1191042238 X:56095543-56095565 CAAACTAAGCATTCAGCAAAGGG + Intergenic
1196556984 X:117099971-117099993 AAGGCTAATGATTTAGCCCAAGG + Intergenic
1200061161 X:153484462-153484484 CGGGCTAGGGAGTCAGGACACGG + Intronic
1200146906 X:153931052-153931074 CAGGCTAAGGACACAGAACGGGG - Intronic