ID: 1178823760

View in Genome Browser
Species Human (GRCh38)
Location 21:35998312-35998334
Sequence CCAGAAAAGCAGAGATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178823752_1178823760 10 Left 1178823752 21:35998279-35998301 CCAGCACCCAGCATCTCTGAAGA 0: 1
1: 0
2: 2
3: 16
4: 232
Right 1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG 0: 1
1: 0
2: 1
3: 45
4: 442
1178823755_1178823760 4 Left 1178823755 21:35998285-35998307 CCCAGCATCTCTGAAGAGGGAGC 0: 1
1: 1
2: 0
3: 12
4: 345
Right 1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG 0: 1
1: 0
2: 1
3: 45
4: 442
1178823756_1178823760 3 Left 1178823756 21:35998286-35998308 CCAGCATCTCTGAAGAGGGAGCG 0: 1
1: 0
2: 2
3: 11
4: 164
Right 1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG 0: 1
1: 0
2: 1
3: 45
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178823760 Original CRISPR CCAGAAAAGCAGAGATTGGA AGG Intronic
900189567 1:1347676-1347698 CCAGAGAAGCAGGGACTGCAAGG + Intronic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900504743 1:3023980-3024002 ACTGAAAGGCAGAGATTGGTAGG - Intergenic
900640731 1:3687013-3687035 CCAGAACAGCAGAGCCAGGAGGG + Intronic
901267420 1:7922364-7922386 TCAGAAAGGCAGAGAGAGGAAGG + Intronic
901758152 1:11453904-11453926 CCAGGACAGCAGAGAGGGGAAGG - Intergenic
901907050 1:12421944-12421966 CCAGAGTAGCAGAGATTACAAGG + Intronic
902072736 1:13754603-13754625 TAATAAAAGCAGAGAGTGGACGG + Intronic
902088754 1:13885017-13885039 CCTGAGAGGCAGAGATTGTAGGG - Intergenic
903064007 1:20688427-20688449 TGATAAAAGCAGAGATGGGAAGG - Intronic
903356506 1:22751383-22751405 CCAGAACAGCAGAGATAACAGGG - Intronic
903957480 1:27035330-27035352 CCAGACACGCAGAGACTGGGAGG - Intergenic
903981215 1:27189643-27189665 CAACAAAAGCAGAGATTTGCTGG - Intergenic
904784073 1:32972697-32972719 GGAGAAAAGCAGAGAAGGGAAGG + Intergenic
905541482 1:38763717-38763739 CCAGAAAAGAAGCATTTGGAAGG - Intergenic
905691275 1:39944836-39944858 CCAGAACAGAAGATATTGCACGG - Intergenic
906942348 1:50266182-50266204 CCAGATAAGGAGAGATGGGGAGG - Intergenic
908015954 1:59836300-59836322 CAGGAAAAGCAGACTTTGGAAGG + Intronic
908285900 1:62600840-62600862 GCAAAAAAGCAGACATTGGTCGG - Intronic
909115130 1:71523914-71523936 ACAGAAAAGCAAAAATTAGAGGG + Intronic
909605214 1:77501055-77501077 CTAGAAAAGCTGAGAATCGAGGG + Intronic
909897966 1:81097557-81097579 CTAGAAAAGCAGAAATTGACTGG - Intergenic
910261585 1:85298475-85298497 TCAGAACAGCATAGATTAGAGGG + Intergenic
911386567 1:97182703-97182725 CCAGAAAAGAGGAGAAGGGAAGG - Intronic
912074645 1:105857583-105857605 CCAGAAAAGCACTGATAGAAAGG - Intergenic
912527859 1:110298041-110298063 CCAGTCCAGCAGAGCTTGGAAGG - Intergenic
912947248 1:114095582-114095604 CTAGAAAAGCAAAGATGGGAAGG + Intronic
913018898 1:114766822-114766844 CCAGAGTAGCTGAGATTGCAGGG - Intergenic
913288090 1:117245901-117245923 AAAAAAAAGCAGAGATGGGAGGG - Intergenic
913356117 1:117923913-117923935 ACAGAAAAGGAAAGGTTGGATGG - Intronic
913488357 1:119355014-119355036 ACAGAAAAGGAGAGGTTGAAAGG + Intergenic
915343011 1:155186437-155186459 CTGGAACAGCAGAGAATGGAGGG - Intronic
915680979 1:157581792-157581814 CCAGAAAAGCTCACATTGGGTGG + Intronic
915793766 1:158704268-158704290 GCAGAAATTCAGAAATTGGAGGG - Intergenic
916152117 1:161804393-161804415 CCAGAAAAGCATAGCTAGGATGG + Intronic
916592176 1:166203016-166203038 AAATAAAAGCAGAGATGGGAAGG - Intergenic
917541116 1:175915698-175915720 CCAGAAAAGCCAAGGATGGATGG + Intergenic
923123881 1:231018670-231018692 CCAGAGAGGCAGAGGTTGCAGGG + Intergenic
923967525 1:239157874-239157896 CCAGGGAAGCAGAGGTTGGCTGG + Intergenic
924274306 1:242369978-242370000 CCAGAAAAACATAAAATGGAGGG - Intronic
924306808 1:242698061-242698083 ACAGAAAAGGAGAGATGGGCGGG + Intergenic
1062797410 10:354912-354934 TCAGACAAGCAGAGATGGGCAGG + Intronic
1063102291 10:2961288-2961310 TTAGAAGAGCAGAGATTGGAGGG + Intergenic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1064145733 10:12824606-12824628 TCAGAAATGCTCAGATTGGAGGG - Intronic
1064509285 10:16071916-16071938 CAAGTTAAGAAGAGATTGGAGGG + Intergenic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1065949979 10:30642853-30642875 CCAGAGAAGCGGAGAATGAATGG + Intergenic
1066354735 10:34671634-34671656 CAAGAAAAGCAGAAACTGAAAGG + Intronic
1069778631 10:70941254-70941276 CCAGAGAAGCATGGAGTGGAGGG - Intergenic
1070307508 10:75248381-75248403 TCAGAAAGGCAGAGCTTGAAGGG + Intergenic
1072788221 10:98299032-98299054 CCACCAATCCAGAGATTGGAAGG + Intergenic
1073687573 10:105772295-105772317 GCATAAAAGCAGAAATTGGTAGG - Intergenic
1075105345 10:119536539-119536561 TGAGAAAGGCAGAGACTGGAGGG + Intronic
1075144104 10:119868784-119868806 CCAGAAAAGTGGACATGGGATGG + Intronic
1076465017 10:130673367-130673389 CCAGAGAGGCAAGGATTGGATGG - Intergenic
1077202713 11:1319581-1319603 TCACAAAAGCAGAAATTGGGGGG - Intergenic
1077718122 11:4601230-4601252 CCAGCAAAGCAGAGACATGATGG + Intronic
1077816021 11:5686046-5686068 CCAGAAGAGAAGAGAGAGGAAGG - Intronic
1078398617 11:11003314-11003336 ATATGAAAGCAGAGATTGGATGG + Intergenic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1079173510 11:18118312-18118334 CCAGAATAGTAGATATAGGAAGG + Intronic
1079558321 11:21789749-21789771 CCAGAAAACAAAAAATTGGAAGG - Intergenic
1080951640 11:37040478-37040500 CCAGAAAAACAGATATGGGTTGG - Intergenic
1081878823 11:46430230-46430252 CCAAAAAAGCTGAGTTTGGTAGG + Intronic
1082834272 11:57640194-57640216 CCAGAGAAACAGAGGCTGGAGGG - Intergenic
1083590537 11:63891354-63891376 CCAGAAAGGAAGAGAATGAATGG + Intronic
1084495565 11:69501238-69501260 CCAGAAATGGAGAGATGGAAAGG + Intergenic
1084514642 11:69629913-69629935 GAAGACAGGCAGAGATTGGAAGG - Intergenic
1085800234 11:79582594-79582616 CAAGAGAAGCAGAGCTTAGAAGG - Intergenic
1086391364 11:86367579-86367601 CCAGCAAATCAGTGATTGGCTGG - Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1090448269 11:126783250-126783272 CCACAGAGGCAGAGATTGTAGGG - Intronic
1090516967 11:127438941-127438963 AAAGAAAAGAAGAGCTTGGAGGG - Intergenic
1091159422 11:133406291-133406313 CCAAACCTGCAGAGATTGGAGGG + Intronic
1092273284 12:7039959-7039981 CCAGGGAGGCAGAGATTGCAGGG - Intronic
1093051544 12:14510316-14510338 CCCGAAAGGCAGAGGTTGCAGGG + Intronic
1093636363 12:21474708-21474730 CCATAAAAGCAGATGTTGGAGGG - Intronic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1095403912 12:41846224-41846246 AGGCAAAAGCAGAGATTGGAGGG - Intergenic
1095405316 12:41861290-41861312 CCAGAAAAGCAGGGATTCCCAGG + Intergenic
1095972154 12:47909688-47909710 CCACAAAAGCAAACATTGGGTGG - Intronic
1096562038 12:52442708-52442730 AGACAAAAGCAAAGATTGGAGGG + Intergenic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1097810088 12:64009710-64009732 CTAGAAAAGGAGAAATTAGAAGG - Intronic
1099935873 12:89124680-89124702 ACAGAATACCAGAGATTGGACGG + Intergenic
1100297544 12:93276588-93276610 CCACAAAAGCACAGACTAGATGG - Intergenic
1101850136 12:108395078-108395100 TAATAAAACCAGAGATTGGAGGG - Intergenic
1102032701 12:109752206-109752228 CCAGAACAGGAGAGTGTGGATGG + Intronic
1102688746 12:114744075-114744097 CCAAAGAAACAGATATTGGAGGG - Intergenic
1102845365 12:116175671-116175693 CCAGAAAAGCAGGTATGAGAAGG + Intronic
1103041771 12:117701753-117701775 AGACAGAAGCAGAGATTGGAAGG + Intronic
1103761850 12:123255924-123255946 CCAAAAATGTAAAGATTGGATGG - Intronic
1103823580 12:123717998-123718020 CCCGAGAGGCAGAGGTTGGATGG - Intronic
1103943261 12:124512368-124512390 AGACAAAGGCAGAGATTGGAGGG - Intronic
1103961363 12:124611076-124611098 CCAGAAGAGAGGAGATGGGATGG - Intergenic
1105369466 13:19789841-19789863 CCTGAAAGGCAGAGATTGCGGGG + Intergenic
1107664312 13:42673248-42673270 CCAGAGAAGCTGAGAAGGGATGG - Intergenic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1110015429 13:70394316-70394338 CCAGAAAAGCAGAGTTCTGGGGG + Intergenic
1110725973 13:78824146-78824168 CCATAAAAGTGGACATTGGATGG - Intergenic
1111344023 13:86925002-86925024 ACAGAAAAGGAGAGGTTGGACGG - Intergenic
1111968849 13:94889450-94889472 CCAGAAGAGCAAAGAAAGGAAGG - Intergenic
1112717574 13:102204435-102204457 CCAGGAAAGCAGAGACAGCAGGG + Intronic
1113264930 13:108606826-108606848 CCATGAAAGCAGGGAGTGGAAGG + Intronic
1113597671 13:111546232-111546254 ACAGAAAGGCAGGGACTGGAGGG + Intergenic
1114571724 14:23673915-23673937 ACAGGAAACCAGAGATGGGAAGG + Intergenic
1114723171 14:24904817-24904839 CCAGAATACCACAGATTGGATGG - Intronic
1115367488 14:32574795-32574817 TCAGAAAAGCAGAATTTAGATGG - Intronic
1115856529 14:37635488-37635510 ACTGAAAGGCAGAGATTGGCAGG + Intronic
1115868926 14:37778604-37778626 CCAGCAAAGCAGAGTTGGGGAGG + Intronic
1116287521 14:42991557-42991579 CCAGAAAAGCAGAGGTTAGACGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117003176 14:51392700-51392722 GCAGAAAAGCATAGATGGGTTGG - Intergenic
1118278876 14:64410744-64410766 CCAGAAAAACAGAGTATGGAGGG - Intronic
1118282970 14:64445994-64446016 CCAAAAAAGCAGAAATAGGTAGG - Intronic
1119737888 14:76995557-76995579 ACAGAAAGGAGGAGATTGGAAGG + Intergenic
1120265328 14:82241326-82241348 GAAGAAAAGCATAGATTGGTTGG - Intergenic
1120433126 14:84444342-84444364 CCAGAAAAGCAAAAAAGGGAGGG - Intergenic
1121512657 14:94523755-94523777 CGACAGAGGCAGAGATTGGACGG - Intergenic
1121566991 14:94917413-94917435 GCAGCAAAGTAGATATTGGATGG + Intergenic
1122046265 14:99026187-99026209 TCATAACAGCAGAGATGGGAAGG - Intergenic
1122251544 14:100443466-100443488 CACGGAAAGCAGAGAATGGAGGG - Intronic
1122409119 14:101517111-101517133 GCAGAAGAGCAGAGACTTGAGGG + Intergenic
1123807208 15:23887250-23887272 TCAGAAAAAGACAGATTGGAAGG + Intergenic
1123887067 15:24736605-24736627 CAAGGAAAACAGAGATTGGAGGG - Intergenic
1123964630 15:25442679-25442701 GCAGAAGAGCAGAGAATGTAAGG - Intergenic
1124593957 15:31078398-31078420 CCAGAAAGGCTGAGTTTGGGGGG - Intronic
1126644656 15:50862841-50862863 CCAGAATATCATAGACTGGATGG - Intergenic
1126669473 15:51103036-51103058 CCAGAAAAGAAGAAAAGGGAAGG - Intronic
1126841766 15:52724324-52724346 CCAGAAATGGAGAGCTTGAATGG - Intergenic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1127231491 15:57000482-57000504 CAACAAAAGCAGTGCTTGGAAGG + Intronic
1127505240 15:59591662-59591684 CCAAAAAAGCAGAGGCTAGAAGG - Intergenic
1128480531 15:68033793-68033815 CCAGAAATTCAGAGACTGGCAGG - Intergenic
1129912639 15:79241056-79241078 CCAGAAAAGCTGAGCCTGGAAGG + Intergenic
1131761585 15:95628576-95628598 CCAGAACAACATAGAATGGAAGG + Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1133430590 16:5733729-5733751 ACAGGAAAGAAGAGATAGGAAGG - Intergenic
1133621336 16:7529499-7529521 CCAAAATAGCAATGATTGGATGG - Intronic
1134281676 16:12822375-12822397 ACAGAAAAGAAGAGTTTAGATGG + Intergenic
1135187785 16:20330023-20330045 CCAGACAACCACAGATTGGCTGG - Intergenic
1135643493 16:24141624-24141646 CTAGAAAAGATGAGTTTGGAAGG + Intronic
1135935178 16:26773886-26773908 CCAGAAATCCAGAGTTTGTATGG + Intergenic
1136649100 16:31650792-31650814 CTAGAAGTGCAGAGATTGGCTGG + Intergenic
1138606779 16:58094873-58094895 CCAGAAGAGCAGAGCTGGGGAGG + Intergenic
1139374882 16:66490833-66490855 TCTGAAAAGCTGAGATTGGAGGG - Intronic
1141855230 16:86676736-86676758 CCAGAAAAGCACAGAGTGGTAGG + Intergenic
1141969964 16:87474570-87474592 CAAGACAAGCAGAAACTGGAGGG + Intronic
1143059593 17:4188739-4188761 CCAGAATAGCTGGGATTGCAGGG - Intronic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1144481693 17:15635178-15635200 TCAGAATATCAGAGCTTGGATGG + Intronic
1144816188 17:18037179-18037201 CCAGTAAAGAAGAGAAAGGAAGG - Intronic
1144870281 17:18365308-18365330 CCAGAGAGGCAGAGGTTGCAGGG - Intergenic
1144916603 17:18728537-18728559 TCAGAATATCAGAGCTTGGATGG - Intronic
1146459933 17:33038316-33038338 CCAAAAAGGCAGAGATTTGCTGG - Intronic
1146505209 17:33399043-33399065 CCAGAGAAGCAGAGAAAAGAAGG + Intronic
1146541605 17:33700796-33700818 CCAGAACCGGAGAGATGGGAGGG + Intronic
1147621919 17:41873797-41873819 CCAGAAAAGGTGAGCATGGAGGG - Exonic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148201432 17:45752528-45752550 ACTGAAAAGGAGAGAATGGAAGG - Intergenic
1148290294 17:46441069-46441091 CCAGAACTGCAGATATGGGAAGG - Intergenic
1148312462 17:46658642-46658664 CCAGAACTGCAGATATGGGAAGG - Intronic
1148787690 17:50153345-50153367 CCAGACAGGCAGAGAAGGGATGG - Intergenic
1148857335 17:50585911-50585933 ACAGAAGAGCAGAGATTTCAGGG + Intronic
1148961910 17:51400596-51400618 CAAGAAAAGGAGAGATAGGATGG - Intergenic
1149456284 17:56791216-56791238 CAAGAAAAGCAGAAATTTGGAGG - Intergenic
1149732837 17:58963309-58963331 CCAGAGAGGCAGAGGTTGCAGGG + Intronic
1150446569 17:65231185-65231207 CCGGAAAAGCAGAGGTAGGGTGG + Intergenic
1151725475 17:75881363-75881385 CCAGAACACCAGAGACTGGGTGG + Intronic
1151989451 17:77564841-77564863 ACAGAAAAGGAGAGCTGGGAAGG - Intergenic
1155369705 18:25084790-25084812 CCAGAAAAGCTACTATTGGATGG - Intronic
1155481893 18:26298047-26298069 CCAGAATAGCTAAAATTGGAGGG - Intronic
1155642533 18:28036690-28036712 TCAGCAAAACAGAGATTGGGTGG + Intronic
1156156577 18:34309819-34309841 CCAGAAAAACAGACACTGGTAGG - Intergenic
1156787600 18:40934320-40934342 AATGAAAAGCAGACATTGGATGG - Intergenic
1156951017 18:42897921-42897943 CAAGAAAACCAAAGATTGTATGG + Intronic
1157173037 18:45425535-45425557 TCACAAAAACAGAGATGGGATGG + Intronic
1157304044 18:46503746-46503768 CCAGAAAAGCATGCAGTGGAAGG - Intronic
1157785504 18:50478429-50478451 TCAGAAAAGCAGAGGATGGGAGG - Intergenic
1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG + Intronic
1158210188 18:55040389-55040411 CCAGAAAAGAAGAGAAAGAAGGG + Intergenic
1159219618 18:65442325-65442347 CCAAAAGAGGGGAGATTGGAAGG - Intergenic
1159534277 18:69695263-69695285 CCAGAAATGATAAGATTGGAGGG + Intronic
1159993567 18:74940202-74940224 CCAGAGAGGCAGACATTGTATGG + Intronic
1160233574 18:77067749-77067771 CCAGGAAATGAGAGATTGGGTGG - Intronic
1160263772 18:77320500-77320522 TCAGAAAAGCAGAAATTACAGGG - Intergenic
1161010549 19:1957643-1957665 CCACACAGGCAGAGACTGGAGGG + Intronic
1161078064 19:2296095-2296117 CCAGAAAAACAGTGCTGGGAGGG - Intronic
1161079991 19:2305853-2305875 CCCCAAAAGCAGACCTTGGAGGG - Intronic
1161812922 19:6481126-6481148 GGAGGAAAGCAGAGATTGCAGGG - Intronic
1161912222 19:7202944-7202966 CCAAAAAAGCAGACATTGTACGG - Intronic
1162081463 19:8220301-8220323 CCAGAAAAGAAGAGAGAGGGAGG - Intronic
1162876424 19:13624098-13624120 CCACAAAAGCAGACACTGAACGG + Intergenic
1163538627 19:17893433-17893455 GCAGAGAAGCAGAGAAAGGAGGG + Intronic
1164573571 19:29391907-29391929 GCAGACAAGGAGAGAGTGGAGGG - Intergenic
1165066080 19:33229250-33229272 CTAAAAATGCAGAGATTGGCCGG + Intergenic
1165642159 19:37398797-37398819 CCAGAATAGCAGGGTTTTGAGGG - Intergenic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166499165 19:43328309-43328331 CCAGGAAAGCAGAGAAGGGGTGG + Intergenic
1167567488 19:50266023-50266045 GCAGAAAAGGAGAGAATAGAAGG + Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925838349 2:7966867-7966889 CCACATAAGAAGAGATTGGGAGG - Intergenic
926462941 2:13155700-13155722 ACAGAAATGCAGAGATTTAATGG - Intergenic
926531616 2:14054049-14054071 CCAGAAACTCAGAGAAAGGAGGG - Intergenic
926688306 2:15715521-15715543 CCAGAAAAGCTGACCTTGGCCGG - Intronic
926978802 2:18544246-18544268 TCAGAGAAGTAGAGATAGGAAGG - Intergenic
927710078 2:25319534-25319556 CCAGTACAGGAGAGATGGGAAGG + Intronic
927909866 2:26889726-26889748 CCAGAAGGGAAGAGATTTGAGGG - Intronic
928170896 2:29002479-29002501 CCAGAAGAACAGGGAGTGGAAGG - Intronic
928975427 2:37082143-37082165 CCGGAAAGGCAGAGGTTGCAAGG - Intronic
929032085 2:37658614-37658636 CCAGGAAAGCATAGTTTGGAAGG - Intronic
929424645 2:41831691-41831713 ACAGAACACCACAGATTGGATGG + Intergenic
929605374 2:43230553-43230575 CCAGAAAAGGGGAGAGGGGAGGG + Intergenic
930177899 2:48318559-48318581 CCAAAAGAGTAGAGATCGGAAGG - Intronic
930371737 2:50510117-50510139 ACAGAATACCATAGATTGGATGG - Intronic
931079973 2:58758040-58758062 CCAGAAAAGAAAAGAATTGAAGG - Intergenic
931771114 2:65499010-65499032 ACATAAAAGCAGAGCTGGGAAGG + Intergenic
932206676 2:69889513-69889535 CCACACAGGCAGAGATTGGATGG - Intergenic
932956945 2:76363090-76363112 TCAGAAAAGAAGAGAGTTGAGGG + Intergenic
933031244 2:77331497-77331519 CAATAAAAGGAGAGAATGGATGG - Intronic
933497839 2:83073009-83073031 CAGGTAAAGCAGATATTGGAGGG + Intergenic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
934070206 2:88376883-88376905 TCAGAAAAGCTAGGATTGGAAGG - Intergenic
935510708 2:103969754-103969776 GCAGAAAAGCAGAGAAAGAAAGG - Intergenic
936535305 2:113306491-113306513 CCATAAAAGCAGAGGTGGGATGG + Intergenic
938770449 2:134496704-134496726 ACAGACAAGGAGAGCTTGGAAGG + Intronic
939135227 2:138285673-138285695 CCACAGAGGCAGAGATTGGATGG - Intergenic
940251781 2:151685677-151685699 CCAGAAAACCAGACAATGAAGGG - Intronic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
940914148 2:159236354-159236376 CCTGAAATGCATTGATTGGATGG + Intronic
944405367 2:199377922-199377944 CCATGAGAGCAGAGAGTGGAAGG + Intronic
944541863 2:200761689-200761711 CCAGAAAATCACATGTTGGAAGG + Intergenic
946450120 2:219772634-219772656 CCAGAAAACCAGGGGTAGGAAGG + Intergenic
946565994 2:220966425-220966447 CCAGCAGACCTGAGATTGGATGG - Intergenic
947017521 2:225637794-225637816 CCAGAAAAGGAGAACTGGGAGGG + Intronic
947290034 2:228562826-228562848 CAGGAAAATCAGAGATGGGAGGG - Intergenic
947591972 2:231390981-231391003 CCAAGAGAGCAGGGATTGGAGGG + Intergenic
947746257 2:232508762-232508784 CCAGAAAAGCTGACCGTGGATGG - Intergenic
948328590 2:237147244-237147266 CAAGAAAAGCAGAGAGAGAAAGG + Intergenic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1169323704 20:4657377-4657399 CCTGAAAAGTAGAGAAAGGAGGG - Intergenic
1169636781 20:7701065-7701087 CCAGAGAGGAAGAGCTTGGAGGG + Intergenic
1169975710 20:11324997-11325019 GCAGAATACCAGAGACTGGATGG - Intergenic
1170513177 20:17100371-17100393 GCAGAAAAGAGGAGATAGGAGGG - Intergenic
1170889269 20:20365018-20365040 CCAGGATAGGAGAAATTGGAGGG + Intergenic
1173175972 20:40765178-40765200 ACAGAAAACCAGAGATTGCAAGG - Intergenic
1173834480 20:46116344-46116366 CCAGAAATTGAGAGCTTGGAGGG + Intergenic
1173921455 20:46749217-46749239 CCAGAAAAGCATAGAATGGTGGG - Intergenic
1174105523 20:48159969-48159991 CCAGAAATGCAGAGCAGGGATGG + Intergenic
1174144021 20:48438263-48438285 CCACAAAGGTAGAGATTGAAGGG - Intergenic
1174705666 20:52653274-52653296 CCAGTAGTGCAGAGAGTGGAAGG + Intergenic
1175029446 20:55937748-55937770 AGAGAAACGCAGAGATAGGAGGG + Intergenic
1175469387 20:59216339-59216361 CCAGTGAAGCAGAGAAGGGAAGG - Intronic
1176675765 21:9775847-9775869 CCAGGAAGTCAGAGATTGCAGGG - Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177787703 21:25690133-25690155 CCACAAAAGCAGAGAACAGAGGG + Intronic
1178642419 21:34355818-34355840 AAAGAAAAGCAGAGGCTGGAGGG + Intergenic
1178669299 21:34576956-34576978 CCAGAACATCAGAGATTAGTTGG + Intronic
1178781557 21:35607841-35607863 TAAGAAAAGCAGATATGGGAAGG - Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1179015460 21:37591577-37591599 CCAGAAAAGCGGAGAAGGGGTGG + Intergenic
1179257047 21:39726292-39726314 CCAGAAATTCAGAAATTAGATGG + Intergenic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1180151929 21:45952982-45953004 AAAGAAATGCAAAGATTGGAAGG - Intergenic
1180282171 22:10711390-10711412 CCAGAAAAGTAGAAATAGAATGG + Intergenic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1181768004 22:25105730-25105752 CCAGAAAAGCAGAGACCAAATGG - Intronic
1182029879 22:27150148-27150170 CCAGAAAACCAGGCATTGAAGGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182748329 22:32622615-32622637 CCAGAAAGTCAGAGCTGGGAGGG + Intronic
1183765083 22:39865893-39865915 CTAGAGAAGCAGAGATGGCAGGG - Intronic
1184875683 22:47274016-47274038 CCAGAAAAGCAAAGGAAGGATGG - Intergenic
1184975884 22:48061613-48061635 CCAGAAAGCCAGAGCTGGGAGGG + Intergenic
1185173006 22:49304384-49304406 CCAGCAAAGCACAGGCTGGAGGG + Intergenic
950043565 3:9934957-9934979 CCAGCAGAGCAGAGATTTGGCGG - Intronic
950106770 3:10393523-10393545 CCAGGAAGGCAGAGCTGGGATGG + Intronic
950350594 3:12347376-12347398 CCATAAAAGCAGACAAAGGAAGG - Intronic
950768916 3:15294962-15294984 ACAGAAGAGCAGAGATCTGAGGG - Intronic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
951988350 3:28646610-28646632 CCGGAAAAGCTGAGAGTGCAAGG - Intergenic
952849205 3:37713858-37713880 CCAGAAATAAAAAGATTGGAGGG - Intronic
952855243 3:37764817-37764839 CCAGCTATGCAAAGATTGGAGGG - Intronic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
953772673 3:45790911-45790933 ACAGAAAAGCACACATTTGAGGG - Intronic
953842059 3:46397036-46397058 CCTGAAAAGCAGACATTAGGAGG + Intergenic
953853248 3:46481673-46481695 CCTGAAAGGCAGAGGTTGCAGGG + Intronic
955230662 3:57096460-57096482 CCAGAAGAGAGGAGCTTGGAAGG + Exonic
958541982 3:95489387-95489409 CCAAAGAATTAGAGATTGGAGGG - Intergenic
958978540 3:100694287-100694309 ACAGAAAAGCAGTGACTAGAAGG + Intronic
959006175 3:101022449-101022471 CCAGAAAGGGGGAGAATGGAGGG - Intergenic
959600157 3:108172793-108172815 CAAGAACAGCAGAGATTTTAGGG + Intronic
960550532 3:118971466-118971488 CCTGAAAAGAAGTGACTGGAAGG + Intronic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
962082786 3:132158197-132158219 CTTGAAAATCAGTGATTGGAGGG - Intronic
962327669 3:134449437-134449459 CAGGAAACACAGAGATTGGAAGG - Intergenic
963005088 3:140719439-140719461 GCAGAAGAGCATATATTGGATGG + Intergenic
964458870 3:156898585-156898607 CAAAAATAGCATAGATTGGATGG - Intronic
965097364 3:164249571-164249593 CCATATAAGAAGAGATTGCAGGG - Intergenic
966135445 3:176693075-176693097 CCAGAAAAGCATAAACTTGAGGG + Intergenic
966263099 3:178003354-178003376 ACAGAATACCATAGATTGGATGG - Intergenic
966273989 3:178142452-178142474 CCATAAAAGCAGGGACTGGCTGG + Intergenic
967212389 3:187180290-187180312 CCAGGAAAGCAGAGAAGGGGTGG + Intronic
967418981 3:189252550-189252572 CCAGAAAAGTAGAGGAAGGAGGG + Intronic
967527181 3:190508495-190508517 GCAGATAAATAGAGATTGGAAGG + Intergenic
967706028 3:192651979-192652001 TGAGAAGAGAAGAGATTGGAAGG + Intronic
967910161 3:194536073-194536095 CCAGGGAAGCAGAGATTGCAGGG + Intergenic
969051528 4:4376701-4376723 CAAGAGAGGCAGAGACTGGAGGG - Intronic
969685213 4:8668397-8668419 CCTCAAAAGAAGAGAATGGAGGG + Intergenic
970203771 4:13635192-13635214 TAGGAAAAGCAGAAATTGGAGGG + Intergenic
970595947 4:17600386-17600408 CCTGAAAAGCAGAGCTTCTAGGG + Intronic
970750922 4:19359878-19359900 CCAAGAAAACAGAGATTGGCAGG + Intergenic
970914753 4:21320218-21320240 GCAGATAAGCAGAGTTTGGAGGG + Intronic
971119340 4:23686827-23686849 TCTGAAAATCAGAGGTTGGAAGG - Intergenic
971232591 4:24812004-24812026 CCATGGCAGCAGAGATTGGAAGG - Intronic
971277732 4:25214373-25214395 ACAACAGAGCAGAGATTGGACGG + Intronic
971911512 4:32801719-32801741 CCAAGAAAGCAGAGGTTTGACGG + Intergenic
973735838 4:53870850-53870872 GAAGAAAAGAAGATATTGGAGGG - Intronic
973918796 4:55663587-55663609 ACAGAAAACCAGGGATTGGGAGG - Intergenic
974108780 4:57501855-57501877 GCAGAGAAGCAGAGATTGTAGGG + Intergenic
974123008 4:57662807-57662829 CCAGAAAAGCAGAGGTGGCTGGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
974405456 4:61462469-61462491 CCAGAATAGGAGAGACTGGGTGG + Intronic
974695361 4:65361465-65361487 ACAGGAAAGCAGTGATTTGAGGG + Intronic
975088207 4:70368561-70368583 TCAGAAAAGAGGAGAGTGGAAGG + Intergenic
975603776 4:76131452-76131474 CAAAAAAAGCACAGATTGAAAGG + Intronic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
977061220 4:92258942-92258964 CCAGATAATCAGAAATTAGATGG - Intergenic
977084268 4:92574649-92574671 CCTAAAACCCAGAGATTGGAGGG - Intronic
977580765 4:98722827-98722849 CCAGAAAACAAGAGAATAGATGG + Intergenic
977866849 4:102039013-102039035 TCAGATAAGCAGAGATGGAAAGG - Intronic
978807955 4:112820253-112820275 CCTGAAAAGCAGAAATCTGAAGG - Intronic
979161208 4:117463842-117463864 CAAGAAAAGGAGAGACAGGATGG - Intergenic
979423598 4:120536975-120536997 CCAGAAATGAAGAGATTAAAAGG + Intergenic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
979776961 4:124601832-124601854 AAAAAAAAGCAGAGATTTGAGGG - Intergenic
980871443 4:138615636-138615658 ACAGAGAAGCAGAGAATAGAAGG + Intergenic
982056646 4:151556684-151556706 CCTTAAAACCAGAGATTGAAAGG + Intronic
982087893 4:151854692-151854714 CCAGAAAAGCAGAGGATGAAAGG + Intergenic
982348168 4:154384721-154384743 CCAGGGAAGCAGAGATTGAAGGG + Intronic
985225656 4:187759034-187759056 ACAGAACTGCAGAGAATGGAAGG + Intergenic
986560102 5:9052038-9052060 CCAGAAAAGGGGAGATGGGGCGG + Intronic
987334967 5:16890762-16890784 CCCGAGAAGCAGAGGTTGCAGGG + Intronic
987472126 5:18345206-18345228 ACAGAATACCAGAGACTGGATGG + Intergenic
987761524 5:22169039-22169061 CTAGAGAAACAGAGATTGGATGG - Intronic
988317501 5:29649557-29649579 CCAGATAAGCAGAGATATGGGGG + Intergenic
988955375 5:36311104-36311126 CCAGAGAGACAGAGACTGGAAGG + Intergenic
989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG + Intronic
989343186 5:40400252-40400274 CTAGAAAAGCAGAGATAAGTTGG + Intergenic
990662187 5:58028281-58028303 CCAGAAAAGCAGAAGTTAAATGG - Intergenic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
991896312 5:71402506-71402528 CTAGAGAAACAGAGATTGGATGG - Intergenic
992194028 5:74322127-74322149 CCAGGATAGCAGAGATGAGAAGG - Intergenic
992421198 5:76606910-76606932 ACAGAAAAGCAGTGAATGTATGG - Intronic
992763605 5:79973845-79973867 CCACAAAAGCAGGGATTTGGTGG + Intergenic
992806029 5:80338945-80338967 CCAGAAAAGCTGGGATTACAGGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994225785 5:97250221-97250243 TCAGAAAAGAAGGGATGGGAAGG + Intergenic
994732629 5:103511332-103511354 CCAGGAAAGCAGAGGTGGAAAGG - Intergenic
994843975 5:104961740-104961762 CCAGAAAAGTAAAGTTTTGAAGG + Intergenic
996198548 5:120641027-120641049 CCAGAAGAGCAGAGTATGGGTGG + Intronic
996240206 5:121189634-121189656 CCACCAGAGCTGAGATTGGAAGG - Intergenic
997407216 5:133660391-133660413 ACAGCTAAGCCGAGATTGGAAGG + Intergenic
997428058 5:133817760-133817782 CCAGAAATACAGAGTATGGAGGG + Intergenic
997651007 5:135520603-135520625 CCAAAAGAGCAGAGTTTGGATGG - Intergenic
997822683 5:137079901-137079923 CCAGAAGAGCAGGCATGGGACGG - Intronic
999719953 5:154392207-154392229 CTATATAAGCTGAGATTGGAAGG - Intronic
1000260551 5:159584480-159584502 ACAGAATACCAGAGGTTGGATGG + Intergenic
1001033803 5:168282315-168282337 CCATGAAAGCTGAGACTGGAGGG + Intergenic
1001307700 5:170587643-170587665 TGACAGAAGCAGAGATTGGAGGG - Intronic
1002458793 5:179362156-179362178 CCAGGGAGGCAGAGATGGGAGGG - Intergenic
1002999865 6:2320800-2320822 CCAGAAAATAAGATATTGCATGG - Intergenic
1003021830 6:2516689-2516711 CCAGAATAGCAAAGAGTTGAAGG - Intergenic
1004314498 6:14574039-14574061 TCAGAAAAGAGGACATTGGAGGG + Intergenic
1004962734 6:20809776-20809798 ACAGAAAATCAGAGATTGATTGG + Intronic
1005354959 6:24973519-24973541 CCTGGAAGGCAGAGATTGCAGGG + Intronic
1005721297 6:28605047-28605069 TCAGAAAAGCAGAGAGTTGGAGG - Intronic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1006269441 6:32952476-32952498 CCAGAAAAACAGACATTTGGAGG + Intronic
1007343558 6:41209439-41209461 GCAGGAAGGCAGAGATTGCAAGG + Intergenic
1007346745 6:41236753-41236775 GCAGGAAGGCAGAGATTGCAAGG - Intronic
1007604244 6:43105478-43105500 GCAGAATAGCAGATATTAGAGGG + Intronic
1008749563 6:54716055-54716077 CAAGAAAAGCTGAAACTGGAAGG - Intergenic
1009028783 6:58032036-58032058 CCAGGAAGGAAGAGAGTGGAAGG + Intergenic
1009204316 6:60783416-60783438 CCAGGAAGGAAGAGAGTGGAAGG + Intergenic
1010710945 6:79173524-79173546 CCATGGAGGCAGAGATTGGAGGG + Intergenic
1012008916 6:93754745-93754767 CCATAGAGGCAGAGATTGGAGGG + Intergenic
1012328439 6:97954006-97954028 GCAGCAAAGCAGTGATTAGAGGG - Intergenic
1012436470 6:99220065-99220087 CCAGAGCAGCAGAGATTCCAGGG - Intergenic
1012448510 6:99330873-99330895 CCAGAAGAGCAGAGGATGGGAGG + Intronic
1012882666 6:104809687-104809709 TGAGGAAAGAAGAGATTGGAGGG + Intronic
1013394032 6:109716181-109716203 CCAGAGATGCAGAGATTTAAGGG - Intronic
1013594482 6:111648418-111648440 CCAGAACAGCTGATATTTGAGGG - Intergenic
1013967134 6:115968320-115968342 CCATAACAGCAGAGTTTAGAAGG - Intronic
1014238946 6:118992975-118992997 ACAGAATACCATAGATTGGATGG - Intronic
1014991793 6:128089084-128089106 CCCGAATAGCTGAGATTGGCAGG + Intronic
1015885985 6:137919141-137919163 ACAGAAAAGCAGCGATTGATCGG - Intergenic
1016204317 6:141453733-141453755 CCAGAAAAGCAGAGAAGGGGTGG - Intergenic
1017463213 6:154670904-154670926 CCAGAACAGCTGAGACTTGAGGG - Intergenic
1017563852 6:155663088-155663110 CCAAAAAAGTAGAGCTGGGAAGG + Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1018519677 6:164633479-164633501 TCACAAAAGCAGAGAGTAGAAGG - Intergenic
1019882230 7:3871975-3871997 CCAGAAAATGAGAAATTGAAGGG - Intronic
1020093993 7:5357588-5357610 CCAGAAAAGCTGAGGCGGGAGGG - Intronic
1020949497 7:14657704-14657726 CCAGAAATGCAGAGTCTGGTGGG - Intronic
1021078386 7:16333538-16333560 CCACAAAAGCAGTGCTTGGTGGG + Intronic
1021585409 7:22202397-22202419 CCAGCAAAACAGCTATTGGATGG - Intronic
1022700142 7:32752706-32752728 CTCTAAAAACAGAGATTGGATGG + Intergenic
1022843709 7:34189860-34189882 ACATAAAAGCAGAGGTGGGAGGG - Intergenic
1023567448 7:41537728-41537750 CCAGCAAAGCATGGATTGCACGG + Intergenic
1025252332 7:57359985-57360007 ACAGAAAAGAAGAGCTGGGATGG + Intergenic
1025938210 7:66054008-66054030 CCCGAAAGGCAGAGGTTGCAGGG - Intergenic
1025957037 7:66190980-66191002 CCTGAGAAGCAGAGGTTGCAGGG - Intergenic
1027969313 7:85058028-85058050 AAAGCAAAGAAGAGATTGGATGG - Intronic
1029152429 7:98490500-98490522 GAAGACAGGCAGAGATTGGAAGG + Intergenic
1029229357 7:99053569-99053591 CAAGAAAAGCAAAGACAGGAGGG - Intronic
1029440203 7:100583139-100583161 CCAGAGAAGCCCAGATGGGAGGG - Intronic
1029947278 7:104545934-104545956 TCACAAAAGCAGAGATAGAAAGG - Intronic
1029984140 7:104906170-104906192 GCAGAACTGCAGAAATTGGAGGG - Exonic
1031218040 7:118922967-118922989 TCAGAAAAGCAGAGAAAGAAAGG - Intergenic
1031219652 7:118949271-118949293 CCAGGAAAGCTGAGGTAGGAGGG - Intergenic
1031614471 7:123864729-123864751 CAAGAGAAACAGAGATTGCATGG + Intronic
1033064918 7:138145475-138145497 CCCGGAAGGCAGAGATTGCAAGG - Intergenic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1034271434 7:149805190-149805212 CCAGAAAAGCAGAAAAAAGATGG + Intergenic
1034272502 7:149810082-149810104 CTTGAATATCAGAGATTGGAGGG + Intergenic
1034557898 7:151861598-151861620 CCAGAAAACCTGGGATGGGATGG + Intronic
1034822194 7:154226386-154226408 GCAGAAGAGCAGAGAAAGGAAGG + Intronic
1035660136 8:1341543-1341565 CAAAAAAATCAGAGATGGGAAGG + Intergenic
1036280720 8:7398325-7398347 CAACAAAAGCAGTGCTTGGAGGG - Intergenic
1036456212 8:8910559-8910581 CAAGAAAAGAATAGATTGGAAGG + Intergenic
1036472579 8:9064261-9064283 CCAGAAAAGCAGAGAAGGGGTGG + Intronic
1037344487 8:17884265-17884287 CCAGAGAGGCAGAGGTTGCAGGG - Intronic
1037422899 8:18722848-18722870 TCAGAAAATTAGAGTTTGGAGGG - Intronic
1037702843 8:21290693-21290715 ACAGAAAAGAACAGGTTGGAAGG + Intergenic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1037930621 8:22878079-22878101 CCAGCCAAGCTGAGTTTGGAGGG - Intronic
1039794444 8:40900299-40900321 CCAGCAGAGCAGAGTGTGGAGGG + Intergenic
1041628787 8:60061571-60061593 CCACAGGAGCACAGATTGGAAGG + Intergenic
1042461913 8:69079791-69079813 CAGGAAAAGCAGTGATTTGAAGG + Intergenic
1042633141 8:70843607-70843629 AAAGCAAAGCAAAGATTGGATGG + Intergenic
1043172167 8:76979272-76979294 CCAGAGAGGCAGAGACTGAATGG + Intergenic
1044035614 8:87299565-87299587 CCAGAAAATCATAGATTAAATGG + Intronic
1044642250 8:94395600-94395622 CCAGAAAAGGAGAGCTAGAAAGG + Intronic
1044689293 8:94861077-94861099 CCAGAAAAACACAGATTTAAAGG - Intronic
1044915194 8:97106103-97106125 ACATACCAGCAGAGATTGGAGGG + Intronic
1045931994 8:107638210-107638232 CCACAAGAGCAGGGACTGGATGG - Intergenic
1046854323 8:119013108-119013130 CCACAAAAGCAGTGCTTAGAAGG - Intronic
1046976001 8:120278378-120278400 CCAGAAAAACAAAAATGGGAGGG + Intronic
1047088202 8:121543213-121543235 ACAGAATAGCAGAGGTGGGATGG + Intergenic
1048088609 8:131213240-131213262 CCAGAATAACAGAGGTAGGAAGG + Intergenic
1048365883 8:133738195-133738217 CCAGGAAAGCACAAGTTGGATGG - Intergenic
1049464688 8:142745465-142745487 ACAGAAAACCAAAGACTGGAAGG - Intergenic
1050093606 9:2040915-2040937 CTGGAAAAGCAGAGATTGTATGG + Intronic
1050515215 9:6436243-6436265 CCAGAAAAGTAAAGATTAAAGGG - Intronic
1051059866 9:13033254-13033276 CAGGAAAAGCTGAGATTGGGAGG + Intergenic
1051198532 9:14590571-14590593 CCAGAAAATAATAGAATGGAAGG + Intergenic
1051246612 9:15118098-15118120 CCAGAAAAGCAGAGTTAGAGTGG + Intergenic
1051345084 9:16144149-16144171 TCAGAAAAGCAGAGTGTGGGTGG - Intergenic
1051830300 9:21268417-21268439 CCAGAAAAGCAGAGAGGAAATGG + Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1053033804 9:34807449-34807471 CAAGAAAAGCCGTGGTTGGAAGG + Intergenic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1054859983 9:69940809-69940831 GCAGAAAAGCAGTGTTTAGAGGG + Intergenic
1054919445 9:70527086-70527108 CCAGAAAGGCAGCGTATGGATGG - Intergenic
1055842399 9:80520415-80520437 CAATGAAAGCAGAAATTGGAGGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056882810 9:90413738-90413760 CCAGAAAAGCAGAGAAGGGGTGG - Intergenic
1057602602 9:96471775-96471797 CCAGAAAAACAGAACTTGGAAGG - Intronic
1057623520 9:96656984-96657006 GCAGAAATGCAGAAATTAGAAGG + Intergenic
1057791772 9:98129474-98129496 CCACAAGAGCAGAGATGGAAAGG - Intronic
1057800664 9:98189525-98189547 GTAGCAAAGCCGAGATTGGAAGG - Intronic
1058173912 9:101715832-101715854 CCAGAAAAACAAAAATTGGAAGG + Intronic
1058516776 9:105784040-105784062 TCAGAAAAGCAACTATTGGATGG - Intergenic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1186313698 X:8346454-8346476 ACAGAAAGGCAGAGAATGGTTGG + Intergenic
1187252648 X:17612759-17612781 CAAAATAAGCAGAGTTTGGATGG - Intronic
1188326570 X:28810521-28810543 ACAGAAAAGCATAGAATGGTGGG + Intronic
1188914954 X:35898963-35898985 CAAGAAAAGGAGAGGTTTGAAGG + Intergenic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1190322893 X:49188798-49188820 AAAGAAAGGCAGAGATTGGGGGG - Exonic
1196545431 X:116959078-116959100 CCACATAAGATGAGATTGGATGG - Intergenic
1196723549 X:118876494-118876516 CGAGAAAAGCACAGAGGGGATGG + Intergenic
1198028335 X:132730819-132730841 CCAGAATGGCAGAGCTGGGAAGG + Intronic
1199259525 X:145755227-145755249 CCAGATTAAAAGAGATTGGAAGG - Intergenic
1200132665 X:153859668-153859690 ACAGAAAAACAGATATTGGAGGG + Intergenic
1201567772 Y:15384573-15384595 CAAGAAAAGCAGAGAAAGAATGG - Intergenic