ID: 1178824720

View in Genome Browser
Species Human (GRCh38)
Location 21:36005296-36005318
Sequence GCCCCAAATGAGCACGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178824720_1178824726 14 Left 1178824720 21:36005296-36005318 CCTGCCCCGTGCTCATTTGGGGC No data
Right 1178824726 21:36005333-36005355 GCCTCAGCCCATCTGCACCCAGG 0: 9
1: 42
2: 738
3: 1312
4: 1025
1178824720_1178824724 -8 Left 1178824720 21:36005296-36005318 CCTGCCCCGTGCTCATTTGGGGC No data
Right 1178824724 21:36005311-36005333 TTTGGGGCTGACGCCATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178824720 Original CRISPR GCCCCAAATGAGCACGGGGC AGG (reversed) Intergenic
No off target data available for this crispr