ID: 1178825086

View in Genome Browser
Species Human (GRCh38)
Location 21:36008543-36008565
Sequence CAATACATGGGACAGATATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178825086_1178825090 17 Left 1178825086 21:36008543-36008565 CCAGATATCTGTCCCATGTATTG No data
Right 1178825090 21:36008583-36008605 AGCTGTAACTCTTTTTAACTTGG No data
1178825086_1178825091 21 Left 1178825086 21:36008543-36008565 CCAGATATCTGTCCCATGTATTG No data
Right 1178825091 21:36008587-36008609 GTAACTCTTTTTAACTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178825086 Original CRISPR CAATACATGGGACAGATATC TGG (reversed) Intergenic
No off target data available for this crispr