ID: 1178829667

View in Genome Browser
Species Human (GRCh38)
Location 21:36045324-36045346
Sequence CTCGTGCTGCATCCTCTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178829667_1178829672 13 Left 1178829667 21:36045324-36045346 CCGGACAGAGGATGCAGCACGAG 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1178829672 21:36045360-36045382 GAAGAGCAGAGTGAAGAAAAGGG 0: 1
1: 0
2: 9
3: 92
4: 1023
1178829667_1178829671 12 Left 1178829667 21:36045324-36045346 CCGGACAGAGGATGCAGCACGAG 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1178829671 21:36045359-36045381 TGAAGAGCAGAGTGAAGAAAAGG 0: 1
1: 1
2: 4
3: 79
4: 816
1178829667_1178829674 20 Left 1178829667 21:36045324-36045346 CCGGACAGAGGATGCAGCACGAG 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1178829674 21:36045367-36045389 AGAGTGAAGAAAAGGGGCCAAGG 0: 1
1: 0
2: 2
3: 44
4: 515
1178829667_1178829673 14 Left 1178829667 21:36045324-36045346 CCGGACAGAGGATGCAGCACGAG 0: 1
1: 0
2: 2
3: 22
4: 211
Right 1178829673 21:36045361-36045383 AAGAGCAGAGTGAAGAAAAGGGG 0: 1
1: 1
2: 9
3: 118
4: 1078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178829667 Original CRISPR CTCGTGCTGCATCCTCTGTC CGG (reversed) Intronic
900089972 1:915980-916002 TTCCTCCTGCATCCTCTGTCGGG + Intergenic
902878893 1:19357855-19357877 GTCGTGCTGCATTCTTTATCTGG - Intronic
903188698 1:21644214-21644236 CACCTGCTGCTCCCTCTGTCTGG + Intronic
903386146 1:22928211-22928233 CTCCTGCTGTCCCCTCTGTCTGG - Intergenic
903453573 1:23471207-23471229 CTCATGCTGCTCCCTCTGCCTGG + Intronic
903874174 1:26461182-26461204 CTGGTGCTGCTTCTTCAGTCTGG + Intronic
904374719 1:30073230-30073252 TACCTGCTGCATCCTCTGCCTGG - Intergenic
904550347 1:31311610-31311632 TTCCTGCTGCATCCTCTGGAGGG + Intronic
904822207 1:33253145-33253167 CTCATGCTGTTCCCTCTGTCTGG - Intergenic
905050575 1:35047449-35047471 CTGGCCCTGCATCCTCTGACTGG + Intergenic
905214983 1:36400641-36400663 CTCGTTCTGCCTGCTCAGTCTGG + Intergenic
907114441 1:51956626-51956648 CTCATGCTGCACCCTCTGCCTGG + Intronic
910162058 1:84283743-84283765 CTTGTGCTGCATTCTGTGTAAGG + Intergenic
910826873 1:91418508-91418530 TTCCTCCTGGATCCTCTGTCTGG - Intergenic
913470128 1:119178928-119178950 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
914816814 1:151069553-151069575 CTCATGCTCCATCCTCTTGCAGG + Intronic
916778287 1:167993380-167993402 CTCGTGCTGTATCATCTTTCGGG - Exonic
918708871 1:187703478-187703500 CTCTCGGTGCCTCCTCTGTCTGG + Intergenic
919486834 1:198157003-198157025 CTCCTGCTGCCGCCGCTGTCAGG - Exonic
920224284 1:204426808-204426830 ATTGTGCTGCATCCTATGTTAGG - Intronic
920251359 1:204624480-204624502 CTGGTGCTGCAAACCCTGTCAGG + Intronic
920570649 1:207014507-207014529 CACATGCTGTTTCCTCTGTCTGG + Intronic
920790116 1:209082019-209082041 TTCATGCTGCATCCTCTGGAGGG + Intergenic
921007502 1:211109206-211109228 CCCATGCTGGATCCTCTGCCTGG - Intronic
921333568 1:214064341-214064363 CTCAGGCTCCATCCTCTTTCTGG - Intergenic
922058974 1:222069273-222069295 CTCATGATTCATCCTCTTTCTGG - Intergenic
922217800 1:223534705-223534727 CTCATGCTGTTCCCTCTGTCTGG + Intergenic
922606909 1:226895138-226895160 GCCGTGCTGCCTCCCCTGTCTGG - Intronic
923226348 1:231941987-231942009 CTCTTTCCCCATCCTCTGTCTGG - Intronic
923367243 1:233274703-233274725 CTCATGCTGTTTCCTCTGCCTGG - Intronic
1062791112 10:307329-307351 CTGGTGCTGCAGCCACTGGCAGG - Intronic
1063037295 10:2298984-2299006 CTCATGCTGCCTGCTATGTCAGG + Intergenic
1068130894 10:52893970-52893992 CTCTTGCTGCTCCCTCTGCCTGG - Intergenic
1072684815 10:97529899-97529921 CTCACACTGCCTCCTCTGTCTGG + Intronic
1074112059 10:110429705-110429727 CTCATGCTGCATTCTCTGCCTGG + Intergenic
1077196077 11:1280837-1280859 CTCGGGCTGCAGCCACTGCCAGG - Intronic
1079293433 11:19209794-19209816 CTCATGCTCCCTCCTCTGCCTGG + Intronic
1082085257 11:48044710-48044732 CTTGGCCTGCATCCTCTCTCTGG - Intronic
1084240767 11:67818116-67818138 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
1086667711 11:89504157-89504179 CTCATGCTATTTCCTCTGTCTGG - Intergenic
1086974642 11:93118045-93118067 CTCTTACTGCCCCCTCTGTCTGG + Intergenic
1090763305 11:129855767-129855789 CTCCTGCTGTATGCTCTGTTCGG + Exonic
1091001530 11:131913843-131913865 GTAGTGCTCCATCCACTGTCAGG - Intronic
1093889089 12:24498045-24498067 CTCCTGCTGCACCCTCAGACAGG - Intergenic
1095593715 12:43935900-43935922 CTCATGCTGAACCCTCTGCCTGG - Intronic
1095831773 12:46595440-46595462 CTAGTTCTCCATCCTCTGACAGG + Intergenic
1099596983 12:84679379-84679401 CACATGCTGCTTCCTCTGTCTGG + Intergenic
1100671955 12:96823447-96823469 CTCTTGCTGTATCCACAGTCTGG - Intronic
1100860411 12:98799715-98799737 CTCGTGCTCCAGCTTCTGGCTGG + Intronic
1101109702 12:101473643-101473665 CACCTGCTGCTTCCTCTGCCAGG + Intergenic
1103915020 12:124371770-124371792 CCAGGGCTGCCTCCTCTGTCCGG + Intronic
1108041808 13:46346298-46346320 CTCCTGCGGCATCCTCTGCCTGG + Intronic
1108554651 13:51581334-51581356 CACATGCTGTTTCCTCTGTCTGG + Intergenic
1115549113 14:34489162-34489184 CTCATGCAGTTTCCTCTGTCTGG - Intergenic
1117328954 14:54693986-54694008 CACTTGCTGCTTCCTCTGCCTGG - Intronic
1118138958 14:63058810-63058832 GTCATGCTGCTTCCTCTGCCTGG - Intronic
1119964737 14:78901737-78901759 CACAGGCTGCCTCCTCTGTCTGG + Intronic
1121089043 14:91168574-91168596 CACGTGCTGCTTCCTCTGCCTGG + Intronic
1122728528 14:103777427-103777449 TTGGTTCTGGATCCTCTGTCAGG - Intronic
1122864879 14:104599228-104599250 CTCCTTCTCCATTCTCTGTCTGG + Intronic
1123976055 15:25555706-25555728 CTCATGGTGCACCCTCTGCCCGG - Intergenic
1124136924 15:27043066-27043088 CTCGTGCTCCTTCCTGTGTCTGG + Intronic
1124388801 15:29234273-29234295 CTCGTGCTGTATCATCTTTCGGG + Intronic
1124880571 15:33638867-33638889 CTCTTGTTACATCCCCTGTCAGG - Intronic
1125677252 15:41509030-41509052 CTCTTCCTGCAGCCTCTGGCAGG - Exonic
1126917046 15:53477465-53477487 CACATGCTGTTTCCTCTGTCTGG - Intergenic
1127267262 15:57372296-57372318 CTCTTCCTGCTTCCTCTCTCCGG + Intergenic
1127470647 15:59287068-59287090 ATAGCCCTGCATCCTCTGTCAGG - Intronic
1127755250 15:62085801-62085823 CTTCAGCTGCATCCTCTGCCTGG - Intergenic
1127766132 15:62187061-62187083 CTCTTGGCGCCTCCTCTGTCTGG - Intergenic
1128932608 15:71718767-71718789 CCCTTCCTTCATCCTCTGTCCGG + Intronic
1129232381 15:74203932-74203954 CCCGTGCTGTTTCCTCTGTGGGG - Intronic
1131375221 15:91917600-91917622 CTGGTGCTCCATCCTCTGAATGG - Intronic
1132120421 15:99170802-99170824 CTCCTGCTGCAGCCCCTGGCTGG + Intronic
1133429197 16:5721857-5721879 CTTGTGCTTGGTCCTCTGTCTGG - Intergenic
1135874607 16:26186600-26186622 TTCCTGCTGCTTCTTCTGTCTGG + Intergenic
1136051044 16:27650218-27650240 CGCTTGCTGCTTCCTCTATCTGG - Intronic
1136110535 16:28061880-28061902 CACAGGCTGCATCCTCTGTCTGG - Intronic
1136676023 16:31906779-31906801 ACCGTCCTGCATCCACTGTCTGG + Intronic
1137334521 16:47534127-47534149 CCCGGGCTGCATGCTCTGTGGGG - Intronic
1138543642 16:57703623-57703645 CTCGTGCTCCATCTTCTCTTGGG - Intronic
1138560599 16:57798596-57798618 CTCGCGGTGCCTCCTCTGTGTGG - Intronic
1140207927 16:72948609-72948631 CTCATGCTGCATCCTCCGTGCGG - Intronic
1140832554 16:78765206-78765228 CTCGTGCTGGATCCTCTGCCAGG - Intronic
1142191645 16:88720900-88720922 CTGGGGCTGTGTCCTCTGTCTGG + Intronic
1144320439 17:14112755-14112777 CTCATGATGCTCCCTCTGTCTGG - Intronic
1148777686 17:50104852-50104874 CCCGTGCTGTCTCCTCTGCCGGG + Intronic
1149637363 17:58181637-58181659 CACTTGCTGTTTCCTCTGTCCGG - Intergenic
1153354560 18:4121211-4121233 CTCTTGCTGTTTCCTCTGTCTGG - Intronic
1155042317 18:22075076-22075098 CTCTTGCTGCCTCCTCTGCCTGG + Intergenic
1155224092 18:23713286-23713308 CTCGTGCTGGTTCCTCTACCTGG + Intronic
1157285489 18:46374568-46374590 CCTGTGCTGCACCCTGTGTCAGG + Intronic
1158624654 18:59060800-59060822 CTCATGCTTCTTCCTCCGTCTGG + Intergenic
1161684209 19:5695088-5695110 CTTGTGCTGCGTCCTCTGCTTGG + Intronic
1164519427 19:28967202-28967224 CTATTGCTGCCACCTCTGTCAGG + Intergenic
1165036312 19:33036500-33036522 CTCTTGATGCCTCCTCTGCCTGG + Intronic
1167415078 19:49365709-49365731 CTCGTGCTGCAGTATCTGTTGGG + Intronic
1168486626 19:56768079-56768101 CTCATGCTGTTTCCTCTGCCCGG + Intergenic
926207465 2:10844254-10844276 CTCCTGCTGTATCCTCTGCCAGG - Intergenic
926225081 2:10961505-10961527 CTCCAGCTGCTGCCTCTGTCTGG + Intergenic
927612847 2:24559204-24559226 CTTTTGCTGCTGCCTCTGTCAGG + Intronic
929311777 2:40434032-40434054 CTCTTCCTGCATGCACTGTCAGG + Intronic
929825372 2:45305721-45305743 CTGCTGCTTCATCCTCTGCCAGG - Intergenic
931292266 2:60883084-60883106 CTCACGCTGCTTCCTCTGTCTGG - Intronic
931708617 2:64968865-64968887 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
931733687 2:65175930-65175952 CTCGTTCTGCCCACTCTGTCCGG + Intergenic
931789537 2:65652336-65652358 CATGTGCTGTATCCTCTGCCTGG + Intergenic
933129284 2:78652967-78652989 TACGTGCTGCTTCCTTTGTCTGG + Intergenic
934884697 2:98014373-98014395 TTCTTGCTGCATTCTCTGGCTGG + Intergenic
936700934 2:115010851-115010873 CAGGTGTTGCATCCTCTGTCTGG - Intronic
939079404 2:137641286-137641308 CACGTGCTCCCTCCTCTGTGTGG + Intronic
944310780 2:198231685-198231707 CTGTTGCTGCATCCACTGTTGGG + Intronic
946056738 2:216909601-216909623 CTTGTGCTCCTTCCTCTGTCCGG + Intergenic
946189271 2:217999200-217999222 CATCTGCTGCATCCTCTGCCAGG - Intronic
946766608 2:223046467-223046489 CTCCTGCTGCATCTTCTACCAGG + Intergenic
948222667 2:236285370-236285392 TTGATGCTGCATCCTCTGTTGGG - Intergenic
948880242 2:240853125-240853147 GTCATGCTGCACCCTCTGCCCGG + Intergenic
948899485 2:240949176-240949198 CACGTGCTGCACCCCCTCTCCGG + Intronic
948971327 2:241429637-241429659 CTCCTGCTTCAGCCTCTGTTGGG - Intronic
1168812873 20:717665-717687 CACGTGCTGTTTCCTCAGTCTGG + Intergenic
1168837771 20:889067-889089 CACATGCTGCATCCCTTGTCTGG + Intronic
1168902027 20:1373074-1373096 CTCTTTATTCATCCTCTGTCTGG - Intronic
1169477489 20:5945362-5945384 CACCTGCTGCTTCCTCTGCCTGG + Intronic
1171392971 20:24812822-24812844 TTCATGCTGCATCCACTGACAGG - Intergenic
1172042816 20:32057948-32057970 CACATGCTGCATCCTCTGGATGG + Intronic
1172268167 20:33635369-33635391 CTTGTGTTGGATCCTCTTTCAGG - Intronic
1172472724 20:35212241-35212263 GACATGCTGCATCCTCTGCCTGG - Intergenic
1174072871 20:47910919-47910941 CCCTTGCTGCTGCCTCTGTCAGG + Intergenic
1174328037 20:49795228-49795250 CATGTGCTGCTTCCTCTGCCTGG + Intergenic
1174406578 20:50306838-50306860 CCCGTGCTGTTTCCTCTGCCAGG + Intergenic
1174545568 20:51322579-51322601 CTCCTGCTGTGTCCTCTGCCGGG + Intergenic
1174930093 20:54804303-54804325 CTCATGCTGATTTCTCTGTCTGG - Intergenic
1175615295 20:60393237-60393259 CTCGTGCTTTGTGCTCTGTCTGG + Intergenic
1175788135 20:61724547-61724569 TTCCTGCTGCCTCTTCTGTCTGG - Intronic
1177637533 21:23806878-23806900 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
1178829667 21:36045324-36045346 CTCGTGCTGCATCCTCTGTCCGG - Intronic
1179544685 21:42106211-42106233 CTCGTGCTGCCTCCCCAGGCAGG - Intronic
1180888614 22:19268200-19268222 CTGTTGCTGCATCCTCTGGAGGG - Intronic
1181065040 22:20301642-20301664 CTGGTGCCGCATCTTCTGCCTGG + Intergenic
1183345058 22:37302999-37303021 CTCCTGCTGGATCCCCTGCCAGG - Intronic
1184911800 22:47540230-47540252 CTCCTGCTGCACCCTGTGGCTGG - Intergenic
1184935779 22:47719400-47719422 CTCATGCTGTAGCCTCTGCCAGG + Intergenic
949860481 3:8500690-8500712 CTTGTGTTTAATCCTCTGTCAGG + Intergenic
950004786 3:9684727-9684749 CCCCTGCTCCACCCTCTGTCTGG - Intronic
950404287 3:12795001-12795023 CACCTGCTGCTCCCTCTGTCTGG + Intergenic
950666319 3:14497471-14497493 CACGTGCTGTTTCCTCTGCCAGG - Intronic
951075227 3:18383132-18383154 CCTGTGCTTCATCCTCTGCCTGG - Intronic
953366745 3:42351734-42351756 CTTATGCTGCTCCCTCTGTCTGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
956471062 3:69567250-69567272 CTTATGCTGCTTCCTCTGCCTGG + Intergenic
958751853 3:98201274-98201296 TTCTTGCTGCATCCTCTGGAGGG + Intergenic
961205103 3:125075630-125075652 CTCCTGCTGCAGGCTCTGTGGGG - Intergenic
964418446 3:156474746-156474768 CTCGAGCTGCAGCCTCTGGAGGG - Exonic
964974093 3:162599560-162599582 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
966239819 3:177743854-177743876 ATTGTTCTGCATCCTATGTCAGG + Intergenic
967198263 3:187048401-187048423 CACTTGCTGCATCCTCTGACTGG + Intronic
968799467 4:2732736-2732758 CTCCTGCTGCCTGCTCTGCCTGG - Intergenic
969085978 4:4656697-4656719 TTCTTGCTGCATCCTCTGGAGGG - Intergenic
969342426 4:6550479-6550501 CACGTGCTGTTTCCTCTGCCGGG + Intronic
969736349 4:8993347-8993369 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
969921499 4:10544662-10544684 CCCTTGCTGTTTCCTCTGTCAGG - Intronic
974129051 4:57730389-57730411 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
976786591 4:88828038-88828060 CTCATGCTGTTCCCTCTGTCTGG + Intronic
977429906 4:96918876-96918898 CCCTTGCTGCATCCTCACTCTGG + Intergenic
982112126 4:152066352-152066374 TTCATGCTGTCTCCTCTGTCTGG + Intergenic
985965867 5:3338464-3338486 CTGGTGCTCCCACCTCTGTCTGG + Intergenic
986020431 5:3796493-3796515 CTCATGCTGTTTCTTCTGTCTGG + Intergenic
992184589 5:74231863-74231885 CTCCTGCTGCCACCTCTGGCTGG - Intergenic
992331904 5:75725654-75725676 CTCATGCTGATTCCTCTGTGAGG + Intergenic
992610447 5:78504127-78504149 CTGGTGGAGCATCATCTGTCTGG + Intronic
993510806 5:88769444-88769466 CTCATGATGCATGCCCTGTCCGG - Intronic
995380993 5:111533049-111533071 CTCTTGCTGCTGCCTCTGCCTGG + Intergenic
997035683 5:130188760-130188782 CTCCTGCTGAATACTCTTTCTGG + Intergenic
997953891 5:138263626-138263648 CTCAAGGTGCAGCCTCTGTCTGG - Intronic
998495250 5:142582834-142582856 CCCGTGCTGTCTCCTCTGACTGG + Intergenic
999263082 5:150249507-150249529 CACAGGCTGCTTCCTCTGTCTGG + Intronic
1000279349 5:159768734-159768756 CTGGTGCTTCATACCCTGTCTGG - Intergenic
1002132841 5:177092009-177092031 CTCGGGCTGCGCCCTCTGCCTGG - Intronic
1003982396 6:11402529-11402551 CTCCAGCTGCAACCCCTGTCTGG - Intergenic
1004631657 6:17427166-17427188 CTCTTGCTGTTCCCTCTGTCTGG - Intronic
1007305498 6:40900845-40900867 CTCGTGCTGTGCCCTCTGCCAGG - Intergenic
1010439423 6:75876074-75876096 CACATGCTGCCTCCTCTGTTTGG + Intronic
1013071306 6:106731819-106731841 CACGTGCTGCTCCCTCTGCCTGG + Intergenic
1013422927 6:109982584-109982606 CACTTGTTGCTTCCTCTGTCTGG - Intergenic
1014202328 6:118620596-118620618 CTCTTGCTGAATCATCTGGCTGG - Intronic
1015221988 6:130814388-130814410 CTCTTTCTTCATCCTCTATCTGG + Intergenic
1015247039 6:131086469-131086491 CATGGGCTGCATCCACTGTCCGG - Intergenic
1015375391 6:132504307-132504329 TTCGTTCTCCTTCCTCTGTCAGG - Intronic
1016735712 6:147477691-147477713 CTCTTGCTGCTTCCACTGCCTGG - Intergenic
1017336094 6:153262051-153262073 CTCCTGCTGCAACCTATGTTAGG - Intergenic
1017485785 6:154900812-154900834 CTAATGCTGCCTCCTCTGCCAGG - Intronic
1018284674 6:162224702-162224724 ATGCTGCTGCATCCTCTTTCTGG + Intronic
1019478574 7:1255678-1255700 CTCATGCTGCATCCTCAGAGGGG + Intergenic
1021197579 7:17690225-17690247 CTCATGCTGCACACTCTGACGGG + Intergenic
1021567958 7:22032822-22032844 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
1022040885 7:26580153-26580175 TTCCTGCTGCCTCCTCTCTCAGG + Intergenic
1024085861 7:45890750-45890772 CTCAAGCTACATCCTCTGACAGG - Intronic
1026824094 7:73570558-73570580 CTGCTGCTGCAGCCTCTGGCGGG + Exonic
1028713806 7:93940971-93940993 CTCTTGCTGCATGCTCTTGCTGG + Intergenic
1031794345 7:126152443-126152465 CTCATGCTGCTCCCTCTTTCTGG + Intergenic
1032011160 7:128349098-128349120 TTCTTGCTGCATCCTCACTCTGG - Intergenic
1034558018 7:151862180-151862202 CTAGTACAGCATCCTGTGTCTGG - Intronic
1035392673 7:158515814-158515836 CCCACGCTTCATCCTCTGTCTGG + Intronic
1038444873 8:27596356-27596378 CTCATGTTGGAACCTCTGTCAGG + Intergenic
1040954994 8:52970345-52970367 CTCTTGGTGCTTCCTCTGCCTGG - Intergenic
1041369273 8:57142564-57142586 CTCGTGCCGCATCCTCGGCAGGG + Intergenic
1044505715 8:93016764-93016786 CACCTGCTGCTGCCTCTGTCGGG - Intronic
1044808372 8:96032156-96032178 CACGTGCTGCTCCCTCTGTCTGG - Intergenic
1047523306 8:125612296-125612318 CTCATGCTGCTTCCTCCATCTGG - Intergenic
1051504426 9:17812078-17812100 CTCTTGCTGAATCCTCTGTCTGG - Intergenic
1053700131 9:40681686-40681708 ACTGTCCTGCATCCTCTGTCTGG + Intergenic
1054311423 9:63481084-63481106 ACTGTCCTGCATCCTCTGTCTGG + Intergenic
1054410203 9:64805237-64805259 ACTGTCCTGCATCCTCTGTCTGG + Intergenic
1057274531 9:93669278-93669300 CTTGCCCTGCATCCTCTGGCAGG - Intronic
1057745547 9:97748186-97748208 CTCATGCTGTTTCCTCTGCCTGG + Intergenic
1057772529 9:97981661-97981683 CTTGTGCTACATCATCAGTCTGG - Intergenic
1058295288 9:103298844-103298866 CTCCTACTGGTTCCTCTGTCTGG - Intergenic
1059466881 9:114474558-114474580 GTCATGCTGTACCCTCTGTCTGG + Intronic
1059672597 9:116505843-116505865 CTATTGCTACATCCTCAGTCTGG + Intronic
1059767173 9:117394660-117394682 CTCGAGCTGTGTCCTCTGTCAGG - Intronic
1060148066 9:121268672-121268694 CTCCAGCTGCTTCCTCTTTCTGG + Intronic
1060212433 9:121718776-121718798 CTCGTGTTGTGTCCTCTCTCTGG + Intronic
1060986862 9:127825076-127825098 CTCCTGCTGCGTCTTCTGCCTGG + Intronic
1061234342 9:129333928-129333950 CACTTGCTGCCTCCTCTGCCTGG + Intergenic
1186798169 X:13066708-13066730 CTCTTCCTGAACCCTCTGTCTGG + Intergenic
1188242488 X:27809000-27809022 CTCTTGGTGCCTCCTCTGCCTGG + Intronic
1191181975 X:57574034-57574056 CTCTTGCTGCTGCCTCTCTCTGG - Intergenic
1193040270 X:76997141-76997163 CTCTTGGTGCCTCCTCTGCCTGG - Intergenic
1194675128 X:96785378-96785400 CTCTTGCTGCATCCTCTGGAGGG + Intronic
1194703541 X:97145901-97145923 TTCATGCTGCATCCTCTGGCTGG + Intronic
1194847040 X:98822616-98822638 TTCATGCTGCTTCTTCTGTCAGG + Intergenic
1196775422 X:119333457-119333479 CTCTTGGTGCCTCCTCTGCCTGG + Intergenic
1199302165 X:146225366-146225388 CACTTACTGCTTCCTCTGTCTGG + Intergenic
1200798256 Y:7361681-7361703 TTCATGTTGCATCCTCTGTGTGG + Intergenic
1201260422 Y:12153690-12153712 CTGGTGCTGTATCCTCAGCCTGG - Intergenic
1202580024 Y:26370752-26370774 CACATGCTGTTTCCTCTGTCTGG + Intergenic