ID: 1178831452

View in Genome Browser
Species Human (GRCh38)
Location 21:36060320-36060342
Sequence GCTAGTAGGACTTCCGGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831452_1178831466 23 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831466 21:36060366-36060388 TCCAAGATGGAGGCTGCAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 533
1178831452_1178831458 -8 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831458 21:36060335-36060357 CTACTAGCTCACCTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
1178831452_1178831459 -5 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831459 21:36060338-36060360 CTAGCTCACCTAGGCGCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1178831452_1178831461 10 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831461 21:36060353-36060375 GCCGGCGGCCGCTTCCAAGATGG 0: 1
1: 0
2: 3
3: 21
4: 213
1178831452_1178831463 13 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831463 21:36060356-36060378 GGCGGCCGCTTCCAAGATGGAGG 0: 1
1: 0
2: 57
3: 222
4: 270
1178831452_1178831468 26 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831452_1178831465 22 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831465 21:36060365-36060387 TTCCAAGATGGAGGCTGCAGTGG 0: 1
1: 0
2: 5
3: 35
4: 369
1178831452_1178831469 27 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831452 Original CRISPR GCTAGTAGGACTTCCGGGTC GGG (reversed) Intronic
901846964 1:11989395-11989417 GCTAGTGGGATTTGCGGGTGGGG + Intronic
903576429 1:24342329-24342351 GCTAGGAGGACGCACGGGTCAGG - Intronic
905967661 1:42112930-42112952 GCTGGAAGGACTCCCGGGACTGG - Intergenic
906458724 1:46021136-46021158 GTTAAAAGGACTTCCAGGTCTGG + Intronic
910397883 1:86809884-86809906 GCTAGCTGGGCTTCTGGGTCAGG - Intergenic
916083255 1:161250141-161250163 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
916084292 1:161257386-161257408 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
918489417 1:185065023-185065045 GCCAGCTGGACTTCTGGGTCGGG + Intronic
919914417 1:202130764-202130786 GCTGGTGGTACTTCCGGGCCTGG - Exonic
922610182 1:226920722-226920744 GCTGGTAGGACTTGCAGGCCAGG + Intronic
1066446698 10:35490636-35490658 GCTGGAAAGACTTCCGGCTCTGG - Intronic
1069526341 10:69175383-69175405 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
1069875488 10:71560441-71560463 TCAAGTGGGACTTCCTGGTCTGG - Intronic
1075368970 10:121918785-121918807 GCCAGCTGGACTTCTGGGTCGGG + Intronic
1076574930 10:131458320-131458342 GCTAGGAGGTTTTCCGGGGCTGG - Intergenic
1088494108 11:110416645-110416667 GCCAGGTGGACTTCTGGGTCAGG + Intergenic
1088599713 11:111463446-111463468 GCTAGTAGGAGCTCCAGGGCTGG + Intergenic
1090702700 11:129310720-129310742 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
1094238541 12:28195407-28195429 GCCGGCTGGACTTCCGGGTCAGG - Intronic
1097427985 12:59470944-59470966 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
1102986231 12:117280809-117280831 GCAAGCACGACTTCCGAGTCTGG - Exonic
1108113458 13:47102445-47102467 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
1109503065 13:63263728-63263750 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
1114772194 14:25440635-25440657 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
1119213357 14:72849519-72849541 GCTAGGAGAACTGCCGGGCCTGG - Intronic
1121077757 14:91083577-91083599 GACAGTAGGACATCTGGGTCAGG - Intronic
1123893325 15:24803001-24803023 GCCAGCTGGACTTCTGGGTCGGG - Intergenic
1125529029 15:40399416-40399438 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
1128942754 15:71801965-71801987 GCCAGCTGGACTTCTGGGTCAGG + Intronic
1130215479 15:81964874-81964896 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
1130923222 15:88366253-88366275 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
1131572635 15:93554474-93554496 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
1131692037 15:94837654-94837676 GCCAGCTGGACTTCTGGGTCGGG - Intergenic
1131727970 15:95247896-95247918 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
1131895888 15:97028871-97028893 GCTAGCTGGACTTCTGGGTCAGG - Intergenic
1131908784 15:97173044-97173066 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
1132043663 15:98546724-98546746 GCCAGCCGGACTTCTGGGTCGGG - Intergenic
1132769695 16:1554526-1554548 GCTCTTAGGACTTCAGGCTCTGG - Intronic
1137375803 16:47950720-47950742 GCCAGCTGGGCTTCCGGGTCAGG + Intergenic
1145813758 17:27781120-27781142 GCAAGCACGACTTCCGGGTGTGG - Exonic
1147708120 17:42442335-42442357 GCTAGTAAGACTGCAGGGTTTGG - Intergenic
1150693581 17:67385108-67385130 GCCAGTTGGACTTCTTGGTCCGG + Intronic
1156764513 18:40635385-40635407 GCCAGTTGGACTTCTGGGTCAGG - Intergenic
1159346681 18:67215676-67215698 GCTGGTTGGGCTTCTGGGTCGGG - Intergenic
931470739 2:62535908-62535930 GCCAGCTGGACTTCTGGGTCGGG - Intergenic
931825844 2:66000275-66000297 TCAAGTAGGACTTTAGGGTCTGG - Intergenic
942101769 2:172590886-172590908 GCCAGTTGGGCTTCTGGGTCGGG - Intronic
943899385 2:193412697-193412719 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
943902376 2:193456385-193456407 GCCAGTTGGGCTTCTGGGTCGGG + Intergenic
948643393 2:239389025-239389047 GCCAGCTGGACTTCTGGGTCGGG + Intronic
1175309051 20:57998802-57998824 GCTGGAAGGGCTTCCGGGTAGGG + Intergenic
1175855490 20:62118749-62118771 GCTAGGAGGACTTCCGGGCAGGG - Intergenic
1178831452 21:36060320-36060342 GCTAGTAGGACTTCCGGGTCGGG - Intronic
1179201678 21:39229129-39229151 CCTACTATGACTTCAGGGTCAGG + Intronic
949723220 3:7014816-7014838 GCCAGCTGGACTTCTGGGTCGGG + Intronic
949843783 3:8350320-8350342 GCCAGTTGGACTTCTGGGTTGGG - Intergenic
952940290 3:38439072-38439094 GCCAGTTGGACTTCTGGGTTGGG - Intergenic
953094610 3:39762634-39762656 GCTAGCAGGACTTCAGGGCAGGG + Intergenic
956035963 3:65092291-65092313 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
957888146 3:86317578-86317600 GCAAGTAGGACTTCAGGAGCTGG - Intergenic
974760013 4:66263018-66263040 GCTACTAGGACTTCATGGTGAGG - Intergenic
977640602 4:99354244-99354266 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
980157922 4:129129348-129129370 AGTAGTGGGAGTTCCGGGTCAGG - Intergenic
983084664 4:163428128-163428150 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
987676647 5:21083219-21083241 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
988631712 5:32938444-32938466 GCTATTAGGACCTCTGGGTTTGG - Intergenic
990117194 5:52403301-52403323 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
990419515 5:55617586-55617608 GCCAGCTGGACTTCTGGGTCAGG + Intergenic
990786284 5:59424092-59424114 CTTAGGAGGACTTCCAGGTCTGG + Intronic
995928608 5:117407592-117407614 GCTGGCTGGACTTCTGGGTCTGG - Intergenic
997726813 5:136127902-136127924 GGTAGTTGAACTTACGGGTCTGG + Intergenic
1001292672 5:170475213-170475235 GCCAGCTGGACTTCTGGGTCGGG - Intronic
1001813567 5:174648987-174649009 GCCAGCTGGACTTCTGGGTCGGG - Intergenic
1002688335 5:181032674-181032696 GCCAGCTGGGCTTCCGGGTCCGG + Intergenic
1005279563 6:24258552-24258574 GCCAGCTGGACTTCTGGGTCGGG - Intronic
1006378481 6:33684636-33684658 GCGAGGTGGACTTCCGGTTCTGG - Exonic
1009385056 6:63077922-63077944 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
1009386296 6:63086712-63086734 GCTAGCTGGACTTCTGGGTTGGG - Intergenic
1011825720 6:91303285-91303307 GCTAGGTGGGCTTCTGGGTCAGG - Intergenic
1023077623 7:36499661-36499683 GCCAGCAGGGCTTCTGGGTCAGG - Intergenic
1040970890 8:53136875-53136897 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
1043690058 8:83140239-83140261 GCTGGTTGGGCTTCTGGGTCTGG - Intergenic
1051555317 9:18376063-18376085 GCCAGCTGGACTTCTGGGTCGGG - Intergenic
1053236340 9:36458154-36458176 GCCAGCTGGACTTCTGGGTCGGG + Intronic
1053615486 9:39761414-39761436 GCTAGTTGGATTTCCGTGTGGGG - Intergenic
1053873652 9:42520677-42520699 GCTAGTTGGATTTCCGTGTGGGG - Intergenic
1054238034 9:62580977-62580999 GCTAGTTGGATTTCCGTGTGGGG + Intergenic
1054262545 9:62882348-62882370 GCTAGTTGGATTTCCGTGTGGGG - Intergenic
1054268680 9:62946079-62946101 GCTAGTTGGATTTCCGTGTGGGG + Intergenic
1054552165 9:66615487-66615509 GCTAGTTGGATTTCCGTGTGGGG + Intergenic
1061789758 9:133052767-133052789 CCTTGTTGGACTTCCGGCTCAGG + Intronic
1062146240 9:134991347-134991369 GCCAGCTGGACTTCCGGGTGGGG - Intergenic
1186192266 X:7077260-7077282 GCTAGGAAGATGTCCGGGTCTGG + Exonic
1188097329 X:26041386-26041408 GCCAGCTGGACTTCTGGGTCGGG + Intergenic
1194449723 X:94029578-94029600 TCAAGTAGGACTTGTGGGTCTGG + Intergenic
1196127738 X:112116744-112116766 GCCAGTTGGACTTCTGGGTAGGG - Intergenic
1196853040 X:119956889-119956911 GCCAGCTGGACTTCTGGGTCAGG - Intergenic
1200960089 Y:8988420-8988442 GCTAGCTGGGCTTCTGGGTCAGG + Intergenic
1201909718 Y:19121638-19121660 GCCAGTTGGACTTCTGGGTTGGG - Intergenic