ID: 1178831453

View in Genome Browser
Species Human (GRCh38)
Location 21:36060321-36060343
Sequence AGCTAGTAGGACTTCCGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831453_1178831463 12 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831463 21:36060356-36060378 GGCGGCCGCTTCCAAGATGGAGG 0: 1
1: 0
2: 57
3: 222
4: 270
1178831453_1178831468 25 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831453_1178831461 9 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831461 21:36060353-36060375 GCCGGCGGCCGCTTCCAAGATGG 0: 1
1: 0
2: 3
3: 21
4: 213
1178831453_1178831459 -6 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831459 21:36060338-36060360 CTAGCTCACCTAGGCGCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1178831453_1178831469 26 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831453_1178831465 21 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831465 21:36060365-36060387 TTCCAAGATGGAGGCTGCAGTGG 0: 1
1: 0
2: 5
3: 35
4: 369
1178831453_1178831458 -9 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831458 21:36060335-36060357 CTACTAGCTCACCTAGGCGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
1178831453_1178831466 22 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831466 21:36060366-36060388 TCCAAGATGGAGGCTGCAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831453 Original CRISPR AGCTAGTAGGACTTCCGGGT CGG (reversed) Intronic
901014041 1:6217634-6217656 AGCCAGCAGGACTTGGGGGTGGG - Intronic
901846963 1:11989394-11989416 AGCTAGTGGGATTTGCGGGTGGG + Intronic
904070272 1:27790579-27790601 AGCCAGCTGGACTTCTGGGTTGG - Intronic
911255813 1:95631996-95632018 AGCTAGAAGGGCCTCAGGGTAGG + Intergenic
911839276 1:102660330-102660352 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
913987080 1:143575136-143575158 GGCTAGCTGGAGTTCCGGGTGGG + Intergenic
916083254 1:161250140-161250162 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
917532769 1:175851804-175851826 AGCTAGTGGGACGTCCTGGAAGG + Intergenic
917976795 1:180245072-180245094 AGCTGGCAGGGCTTCCTGGTTGG + Intronic
918138762 1:181702273-181702295 AGCTAGGAGGACTTGCTGGCTGG - Intronic
918489416 1:185065022-185065044 AGCCAGCTGGACTTCTGGGTCGG + Intronic
919237013 1:194859109-194859131 GGCCAGTTGGAGTTCCGGGTGGG + Intergenic
919377140 1:196808855-196808877 GGCCAGGAGGACTTCCAGGTGGG + Intergenic
919386848 1:196933756-196933778 GGCCAGGAGGACTTCCGGGTGGG + Intronic
1066391653 10:34981550-34981572 AGCTGGTAGGACTGCAGGTTTGG + Intergenic
1069526340 10:69175382-69175404 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
1072374638 10:94802289-94802311 AGCCAGCTGGACTTCTGGGTTGG - Intronic
1075552365 10:123401686-123401708 AGCTGGTGGGACTTCCTGGAAGG + Intergenic
1078317290 11:10304474-10304496 AGCTAGTAAGATTTCACGGTAGG - Intergenic
1080800240 11:35603563-35603585 ACCTAGAAGGTCTTCTGGGTTGG - Intergenic
1083164514 11:60875247-60875269 AGGTAGGAGGGCTTCTGGGTGGG + Exonic
1091574067 12:1715707-1715729 AGCCAGCTGGACTTCTGGGTTGG + Intronic
1092152561 12:6260979-6261001 AGCTAGTGGGACTTACTGATGGG + Intergenic
1093266248 12:17007667-17007689 GGCTAGCTGGACTTCCGGGTGGG + Intergenic
1094320943 12:29182591-29182613 AGCCAGCTGGACTTCTGGGTTGG - Intronic
1096191106 12:49620240-49620262 AACTAGGAGTACTTCAGGGTTGG - Intronic
1096276395 12:50211973-50211995 AGGAAGGAGGACTTCAGGGTGGG - Intronic
1097863744 12:64542965-64542987 AGCTAGATAGAGTTCCGGGTGGG + Intergenic
1102137027 12:110583569-110583591 AGTTAGTAGGAATTGCAGGTGGG + Intergenic
1106679418 13:31994788-31994810 AGCCAGCTGGACTTCTGGGTTGG - Intergenic
1107012866 13:35685239-35685261 AGCCAGCTGGACTTCTGGGTTGG - Intergenic
1107713929 13:43180025-43180047 AGCCAGTTGGACTTCTAGGTTGG + Intergenic
1110647575 13:77906116-77906138 AGCTAGCAGGACTTGCTGATGGG + Intronic
1111710245 13:91802697-91802719 AGCTGGCTGGGCTTCCGGGTCGG - Intronic
1113514241 13:110879804-110879826 AGCCAGTAGGCCTTCCTGGGTGG - Exonic
1120219017 14:81711946-81711968 AGCCAGCTGGACTTCTGGGTTGG + Intergenic
1120844134 14:89111690-89111712 AGCCAGCTGGAGTTCCGGGTGGG + Intergenic
1123893326 15:24803002-24803024 AGCCAGCTGGACTTCTGGGTCGG - Intergenic
1125529028 15:40399415-40399437 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
1128638804 15:69320172-69320194 AGCTAGTTGGCCTCCAGGGTGGG - Intronic
1129171207 15:73809259-73809281 AGCTAGGAGGACTTTCTGGAGGG - Intergenic
1130215478 15:81964873-81964895 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
1131481893 15:92789300-92789322 AGCCAGCTGGACTTCTGGGTCGG - Intronic
1131572634 15:93554473-93554495 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
1131692038 15:94837655-94837677 AGCCAGCTGGACTTCTGGGTCGG - Intergenic
1132043664 15:98546725-98546747 AGCCAGCCGGACTTCTGGGTCGG - Intergenic
1137469526 16:48742243-48742265 AGCTAGGAGGACTGCCTGGAAGG + Intergenic
1139604277 16:68007000-68007022 AGCTAGTAGGACTACAGGAATGG - Intronic
1139919615 16:70451113-70451135 GGCCAGTACGAGTTCCGGGTGGG - Intergenic
1142499468 17:324133-324155 AGCTAGCAGGAATCTCGGGTTGG + Intronic
1142769885 17:2089057-2089079 GTCTAGGAGGACTTCCTGGTAGG + Intronic
1147777188 17:42910656-42910678 AGATAGGAGGACCTCCTGGTAGG + Intronic
1154128779 18:11717229-11717251 GGCCAGTGTGACTTCCGGGTGGG - Intronic
1155611738 18:27674180-27674202 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
1159346682 18:67215677-67215699 AGCTGGTTGGGCTTCTGGGTCGG - Intergenic
1166870410 19:45867107-45867129 CTCAAGGAGGACTTCCGGGTGGG + Intronic
1167833642 19:52048536-52048558 AGCTGGTAGGAGTCCCTGGTGGG - Exonic
1168062550 19:53901004-53901026 AGCTCGTAGGAATTCCAAGTAGG + Intronic
927357268 2:22187605-22187627 AGCCAGTAGAACATCCAGGTAGG - Intergenic
931470740 2:62535909-62535931 AGCCAGCTGGACTTCTGGGTCGG - Intergenic
931876288 2:66516985-66517007 AGATAGAAGGACTTACAGGTAGG + Intronic
941878632 2:170459942-170459964 AGCCAGCATGAGTTCCGGGTGGG - Intronic
942101770 2:172590887-172590909 AGCCAGTTGGGCTTCTGGGTCGG - Intronic
942122878 2:172795769-172795791 AGGTAGAATGACTTCAGGGTTGG + Intronic
943902375 2:193456384-193456406 AGCCAGTTGGGCTTCTGGGTCGG + Intergenic
947026598 2:225744172-225744194 GGCTAGCTGGAGTTCCGGGTGGG + Intergenic
948643392 2:239389024-239389046 AGCCAGCTGGACTTCTGGGTCGG + Intronic
1175254122 20:57628837-57628859 AGCCAGCTGGAGTTCCGGGTGGG + Intergenic
1175309050 20:57998801-57998823 AGCTGGAAGGGCTTCCGGGTAGG + Intergenic
1175855491 20:62118750-62118772 TGCTAGGAGGACTTCCGGGCAGG - Intergenic
1177371112 21:20204944-20204966 AGCTGGCTGGACTTCTGGGTAGG + Intergenic
1178831453 21:36060321-36060343 AGCTAGTAGGACTTCCGGGTCGG - Intronic
1178943033 21:36923275-36923297 AGCTATTAGGAAGCCCGGGTAGG + Intronic
1183204615 22:36410123-36410145 AGCGCGCAGGACTTCCGGGCAGG - Intergenic
949723219 3:7014815-7014837 AGCCAGCTGGACTTCTGGGTCGG + Intronic
949843784 3:8350321-8350343 AGCCAGTTGGACTTCTGGGTTGG - Intergenic
952298288 3:32081090-32081112 AGCTTGGAGGTCTTCCAGGTGGG - Intergenic
952685617 3:36144634-36144656 AGCTAGTAGGAATTCACAGTTGG - Intergenic
952940291 3:38439073-38439095 AGCCAGTTGGACTTCTGGGTTGG - Intergenic
953094609 3:39762633-39762655 GGCTAGCAGGACTTCAGGGCAGG + Intergenic
956035962 3:65092290-65092312 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
959414856 3:106071866-106071888 AGCCAGTTGGACTTCCTGGGTGG + Intergenic
960434540 3:117609594-117609616 AGCCAGCTGGACTTCTGGGTTGG - Intergenic
963021727 3:140878380-140878402 AGCCAGCTGGACTTCTGGGTTGG + Intergenic
964030650 3:152135340-152135362 AGGTTGTAGGACTTCTGGCTGGG - Intergenic
965245270 3:166258785-166258807 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
967229247 3:187321933-187321955 AGTCAGTAGGACTTCCTGGCTGG - Intergenic
970649357 4:18159586-18159608 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
973142067 4:46781722-46781744 AGCCAGCATGAGTTCCGGGTGGG + Intronic
973587786 4:52410062-52410084 GGCTAGCTGGAGTTCCGGGTGGG - Intergenic
978907368 4:114022853-114022875 AGCTAGTAGATCTTTCAGGTTGG - Intergenic
980230279 4:130038859-130038881 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
982679070 4:158408111-158408133 AGCCAGCTGGAGTTCCGGGTGGG + Intronic
985423517 4:189807027-189807049 AGCCAGCTGGGCTTCCGGGTAGG - Intergenic
987251993 5:16109434-16109456 AGTTCGTAGAACTTCTGGGTGGG + Intronic
987379568 5:17272419-17272441 AGCTAGTAGGATTTCCTTATGGG + Intronic
990117193 5:52403300-52403322 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
990418828 5:55612763-55612785 AGCCAGCTGGACTTCTGGGTTGG + Intergenic
997760531 5:136444257-136444279 GGCCAGTTGGAGTTCCGGGTGGG + Intergenic
998744167 5:145237954-145237976 AGCTAGTAGGATTGGAGGGTTGG - Intergenic
1001292673 5:170475214-170475236 AGCCAGCTGGACTTCTGGGTCGG - Intronic
1001697247 5:173680260-173680282 AGCCAGCTGGACTTCTGGGTTGG - Intergenic
1001813568 5:174648988-174649010 AGCCAGCTGGACTTCTGGGTCGG - Intergenic
1003168795 6:3704156-3704178 AGCCAGCTGGACTTCGGGGTTGG - Intergenic
1003578014 6:7315265-7315287 AGCCAGTGCGAGTTCCGGGTGGG + Intronic
1003908101 6:10720638-10720660 CGCCAGTTGGAGTTCCGGGTGGG + Intergenic
1005279564 6:24258553-24258575 AGCCAGCTGGACTTCTGGGTCGG - Intronic
1005332907 6:24766252-24766274 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
1006230236 6:32580168-32580190 AGCCAGCTGGACTTCTGGGTGGG - Intronic
1008218240 6:48822515-48822537 AGCCAGTTAGACTTCTGGGTGGG + Intergenic
1009386297 6:63086713-63086735 AGCTAGCTGGACTTCTGGGTTGG - Intergenic
1011246497 6:85326023-85326045 GGCTAGCTGGAGTTCCGGGTGGG + Intergenic
1012038423 6:94172785-94172807 AGCCAGATGGACTTCTGGGTTGG + Intergenic
1015450646 6:133363113-133363135 AGCTAGCAGACCTTACGGGTGGG + Intronic
1019571772 7:1716200-1716222 GGGTAGTAGGACCTCAGGGTGGG - Intronic
1019991716 7:4696516-4696538 AGCTCGTGGGACTTGCGGGGTGG + Intronic
1021943274 7:25700805-25700827 AGCCAGCTGGGCTTCCGGGTTGG - Intergenic
1024700664 7:51901211-51901233 GGCTAGCTGGAGTTCCGGGTGGG - Intergenic
1025962098 7:66231656-66231678 GGCTAGCTGGAGTTCCGGGTGGG - Intronic
1027790722 7:82636887-82636909 AGCCAGCTGGACTTCCTGGTTGG + Intergenic
1031529440 7:122858239-122858261 AGCCAGCTGGACTTCTGGGTAGG - Intronic
1032722569 7:134562677-134562699 AGCCAGCTGGACTTCTGGGTTGG - Intronic
1039810759 8:41046122-41046144 AGCCAGCTGGACTTCTGGGTCGG - Intergenic
1043164800 8:76890416-76890438 TGCCAGTAGGAATTCCAGGTGGG + Intergenic
1046208918 8:111041154-111041176 GGCTAGCTGGAGTTCCGGGTGGG - Intergenic
1047807438 8:128375045-128375067 AGCCAGCTGGACTTCTGGGTTGG + Intergenic
1047808503 8:128382430-128382452 AGCCAGCTGGACTTCTGGGTTGG + Intergenic
1048789142 8:138084179-138084201 AGCCAGCTGGAGTTCCGGGTGGG + Intergenic
1049087669 8:140490831-140490853 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic
1049586173 8:143433341-143433363 AGCTGGGAGGACTTGGGGGTTGG + Intergenic
1051555318 9:18376064-18376086 AGCCAGCTGGACTTCTGGGTCGG - Intergenic
1053236339 9:36458153-36458175 AGCCAGCTGGACTTCTGGGTCGG + Intronic
1053615487 9:39761415-39761437 TGCTAGTTGGATTTCCGTGTGGG - Intergenic
1053873653 9:42520678-42520700 TGCTAGTTGGATTTCCGTGTGGG - Intergenic
1054238033 9:62580976-62580998 TGCTAGTTGGATTTCCGTGTGGG + Intergenic
1054262546 9:62882349-62882371 TGCTAGTTGGATTTCCGTGTGGG - Intergenic
1054268679 9:62946078-62946100 TGCTAGTTGGATTTCCGTGTGGG + Intergenic
1054552164 9:66615486-66615508 TGCTAGTTGGATTTCCGTGTGGG + Intergenic
1061646189 9:132004029-132004051 AGCTAGGAGGAAGTCCTGGTGGG - Intronic
1062146241 9:134991348-134991370 GGCCAGCTGGACTTCCGGGTGGG - Intergenic
1188097328 X:26041385-26041407 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
1192027485 X:67469558-67469580 AGCCAGCTGGACTTCTGGGTTGG - Intergenic
1192486262 X:71529488-71529510 AGCCAGCTGGACTTCTGGGTTGG - Intronic
1194408918 X:93532873-93532895 AGCCAGCTGGACTTCTGGGTCGG + Intergenic
1196126772 X:112109719-112109741 AGCCAGCTGGACTTCTGGGTTGG - Intergenic
1196127739 X:112116745-112116767 AGCCAGTTGGACTTCTGGGTAGG - Intergenic
1196315066 X:114212471-114212493 AACTGGGAGGACTTCAGGGTTGG - Intergenic
1199628084 X:149758612-149758634 GGCCAGCACGACTTCCGGGTGGG + Intergenic
1201465672 Y:14277903-14277925 AGCAAGTAGGACATTCAGGTGGG + Intergenic
1201479903 Y:14428133-14428155 AGCCAGCTGGAGTTCCGGGTGGG + Intergenic
1201909719 Y:19121639-19121661 AGCCAGTTGGACTTCTGGGTTGG - Intergenic
1202307437 Y:23487615-23487637 AGCCAGCTGGAGTTCCGGGTGGG - Intergenic