ID: 1178831454

View in Genome Browser
Species Human (GRCh38)
Location 21:36060325-36060347
Sequence GGTGAGCTAGTAGGACTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831454_1178831461 5 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831461 21:36060353-36060375 GCCGGCGGCCGCTTCCAAGATGG 0: 1
1: 0
2: 3
3: 21
4: 213
1178831454_1178831463 8 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831463 21:36060356-36060378 GGCGGCCGCTTCCAAGATGGAGG 0: 1
1: 0
2: 57
3: 222
4: 270
1178831454_1178831459 -10 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831459 21:36060338-36060360 CTAGCTCACCTAGGCGCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 23
1178831454_1178831469 22 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831454_1178831470 29 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831470 21:36060377-36060399 GGCTGCAGTGGGCGGGCCCAAGG 0: 1
1: 0
2: 2
3: 45
4: 408
1178831454_1178831468 21 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831454_1178831466 18 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831466 21:36060366-36060388 TCCAAGATGGAGGCTGCAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 533
1178831454_1178831465 17 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831465 21:36060365-36060387 TTCCAAGATGGAGGCTGCAGTGG 0: 1
1: 0
2: 5
3: 35
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831454 Original CRISPR GGTGAGCTAGTAGGACTTCC GGG (reversed) Intronic
900387506 1:2417272-2417294 GGAGATCTGGGAGGACTTCCTGG + Intergenic
902701705 1:18176696-18176718 GGTGAGGTGGGAGGAGTTCCGGG + Intronic
903153415 1:21428825-21428847 GGTGATGTAGTAGAACTTCCTGG - Intergenic
903297019 1:22350507-22350529 GGTGAGCTAGTGCGAGTTCCTGG - Intergenic
904883900 1:33721395-33721417 GGTGAGCTTGATTGACTTCCAGG + Intronic
905223729 1:36466347-36466369 GGGGAGCTTCTAGGGCTTCCTGG - Exonic
906517677 1:46449054-46449076 GGGGAGGAAGCAGGACTTCCTGG - Intergenic
908803655 1:67907433-67907455 GGTGAGCTAGTGTGATTTCTTGG + Intergenic
915929948 1:160054105-160054127 GGAGAGGGAGGAGGACTTCCTGG + Intronic
916318493 1:163477374-163477396 GGTAAGCCAGTGGGCCTTCCAGG + Intergenic
916754518 1:167756246-167756268 GCTGAGATAGGAGGACTGCCTGG - Intronic
917532768 1:175851800-175851822 AGAGAGCTAGTGGGACGTCCTGG + Intergenic
917898393 1:179516491-179516513 GGTGAGCTAGTGTGATTTTCTGG + Intronic
918498497 1:185166593-185166615 GATGAACTAGTAGAACTTGCTGG - Exonic
919377138 1:196808851-196808873 TGTGGGCCAGGAGGACTTCCAGG + Intergenic
919386846 1:196933752-196933774 TGTGGGCCAGGAGGACTTCCGGG + Intronic
919598529 1:199593904-199593926 GGTGAACTAGTATGACTTTCTGG - Intergenic
924208964 1:241745067-241745089 GGAGCACTGGTAGGACTTCCAGG + Intronic
1071167824 10:82827420-82827442 GATGAGCAGGTAGTACTTCCTGG + Intronic
1071568368 10:86683115-86683137 GTTGGGCTGGTAGGTCTTCCCGG + Intronic
1072453568 10:95558187-95558209 GCTGAGGTAGGAGGACTGCCTGG + Intronic
1073514081 10:104061677-104061699 GGGGGTCTAGGAGGACTTCCTGG - Intronic
1075048192 10:119162720-119162742 GGTGAGGGAGAAGGACTTCTAGG - Intronic
1077504445 11:2923633-2923655 GCTGAGCCAGGAGGGCTTCCTGG + Intronic
1077774904 11:5259477-5259499 GGTGAGCTAGTATGATTTTTTGG - Intronic
1078317291 11:10304478-10304500 GGTGAGCTAGTAAGATTTCACGG - Intergenic
1080585772 11:33681862-33681884 GGTGAGCTAGTGTGACTTTTTGG + Intergenic
1086354276 11:85977633-85977655 GGTGAGCGTGTAGGACTTATTGG + Intronic
1086737220 11:90321454-90321476 GGTCATCTAGAAAGACTTCCTGG - Intergenic
1087212793 11:95460682-95460704 GGTGGGCTAGAAGGAATCCCAGG + Intergenic
1088179576 11:107093335-107093357 GGTGAGCTAGTATGATTTTTTGG - Intergenic
1088239627 11:107759645-107759667 GGTGAGCTAGTGTGATTTTCTGG - Intergenic
1093509112 12:19904724-19904746 GGTTATCTAGGAGGACTCCCTGG + Intergenic
1095176396 12:39096562-39096584 GGTGAGCTAGTATGATTTTCTGG - Intergenic
1095419172 12:42007442-42007464 GGAGAGCTAGGAGGACAGCCAGG - Intergenic
1099496878 12:83359217-83359239 GGTGAGTTCTTAGAACTTCCAGG + Intergenic
1099665832 12:85627864-85627886 GTTGAGTCAGCAGGACTTCCTGG - Intergenic
1100113299 12:91271810-91271832 GATGAGCTTGAGGGACTTCCTGG + Intergenic
1103948497 12:124539834-124539856 GGTGAGCCAGGCGGGCTTCCTGG - Intronic
1109437663 13:62327487-62327509 GGAGTGCTAGTATGACTTCATGG - Intergenic
1111667840 13:91292077-91292099 GCAGAGCTGGTAGGACCTCCTGG + Intergenic
1121120070 14:91371015-91371037 GGTGAGGCAGAAGGACTTCAAGG + Intronic
1121644589 14:95509179-95509201 GGTGACTGAGGAGGACTTCCAGG + Intergenic
1121959226 14:98243402-98243424 GGTGAGCTGAGAGGACTCCCTGG + Intergenic
1122038018 14:98962403-98962425 GGGGACCCAGAAGGACTTCCAGG - Intergenic
1125841182 15:42802368-42802390 GGACACCTTGTAGGACTTCCGGG + Intronic
1127275210 15:57437799-57437821 GGTGACCCAGCAGGACTTTCTGG - Intronic
1133157051 16:3882586-3882608 AGTGGGCTAGGAGGGCTTCCTGG - Intergenic
1138483108 16:57317205-57317227 GCTGAGCCAGAAGCACTTCCCGG - Intergenic
1138852699 16:60649213-60649235 TGTGGGCTAGCAGGACTGCCAGG - Intergenic
1143110066 17:4548121-4548143 GGTGAGCACGTGGGATTTCCAGG - Exonic
1144848849 17:18233975-18233997 GGTGAGCCAGCAGAACTTCCCGG - Intronic
1146394917 17:32457030-32457052 AGTTCGCTAGTAGGATTTCCTGG + Intronic
1147434120 17:40396419-40396441 GATGAACAAGTCGGACTTCCTGG - Exonic
1147444557 17:40466903-40466925 GGTTATCTAGAAGGACTCCCAGG - Intergenic
1149535298 17:57429093-57429115 GGAGAGCTAGTGGTCCTTCCTGG + Intronic
1150697954 17:67422052-67422074 GGTGAGCTGGTGTGACTTGCAGG + Intronic
1150945579 17:69742566-69742588 GGTGAGCTAGTATGATTTTTAGG + Intergenic
1151663340 17:75531349-75531371 GGGGAGCTATTCGGCCTTCCTGG + Intronic
1152666089 17:81570483-81570505 AGTGAGCTAGTGGGACTGACGGG + Intronic
1157371334 18:47115095-47115117 GGTGAGCTGGGAGCACCTCCTGG + Intronic
1157598775 18:48879812-48879834 GGTGAGCAGGCAGGACTCCCTGG + Intergenic
1159232231 18:65623853-65623875 GGTGGGGCAGTCGGACTTCCAGG - Intergenic
1161471750 19:4460750-4460772 GGTGAGCTGGAAATACTTCCAGG - Intergenic
1163514248 19:17753586-17753608 GGTGAGCAAGTAGGAGGTCTTGG + Intronic
1163517863 19:17775702-17775724 GGAGATCTAGCAGGGCTTCCTGG + Intronic
1164063725 19:21696290-21696312 GGTGAGCAAGGAGGACTGCAGGG + Intergenic
1165324286 19:35105081-35105103 GTTGACCTAGGAGGACATCCTGG - Intergenic
1166801139 19:45457964-45457986 AGTAAGCCAGGAGGACTTCCTGG - Intronic
1167833644 19:52048540-52048562 GGGGAGCTGGTAGGAGTCCCTGG - Exonic
925326677 2:3027765-3027787 GGTGAGTGAGGAGGACTGCCTGG - Intergenic
925342459 2:3146963-3146985 GGTGATCGATGAGGACTTCCTGG - Intergenic
926082651 2:10000670-10000692 GGTGAGCTTGTAAGACCCCCCGG - Exonic
930028650 2:47045031-47045053 GGTGGGCTGGTAGAACCTCCGGG + Intronic
931001887 2:57794105-57794127 GGTGAGCTTCTGAGACTTCCTGG - Intergenic
943118968 2:183710359-183710381 GGTGAGCTTCTCAGACTTCCAGG - Intergenic
946017745 2:216617592-216617614 TGTGGGCTGGGAGGACTTCCTGG - Intergenic
1169142852 20:3235920-3235942 AGGGATCTAGGAGGACTTCCTGG - Intronic
1169905072 20:10594374-10594396 GGTGAGCCATCAGGACCTCCGGG - Intronic
1171081490 20:22190310-22190332 GGTGAGCTAGTGTAACTTTCTGG + Intergenic
1171848981 20:30294825-30294847 GGTGAGGTGGGAGGACTCCCAGG + Intergenic
1175855492 20:62118754-62118776 GCTTTGCTAGGAGGACTTCCGGG - Intergenic
1178831454 21:36060325-36060347 GGTGAGCTAGTAGGACTTCCGGG - Intronic
1182697189 22:32205520-32205542 GGTGAGTTAGTAGAACTATCAGG + Intergenic
1184684679 22:46090766-46090788 GGAGAGCAAGGAGGGCTTCCAGG - Intronic
951357791 3:21690364-21690386 GGTCAGATAGTAGGACTCCTAGG - Intronic
951678901 3:25274036-25274058 TCTGGGCTAGAAGGACTTCCAGG - Intronic
952903954 3:38127596-38127618 TGTGAGTTGGTAGTACTTCCAGG - Intronic
953966739 3:47313456-47313478 GCTGAGGTAGGAGGACTGCCTGG - Intronic
954533732 3:51342528-51342550 TGTGAGCTAGGAGGGCTTGCTGG - Intronic
955779447 3:62468691-62468713 GGAGAGATAGTGGGACTGCCTGG - Intronic
956950368 3:74274757-74274779 GGTGAGCTAGTATGATTTTTGGG - Intronic
959722200 3:109504907-109504929 GGTGAGCTAGTATGATTTTTTGG + Intergenic
960470360 3:118056834-118056856 GGAGACCTAATAGGGCTTCCTGG + Intergenic
963804183 3:149706779-149706801 GCTGAGCTGGCAGGACTTCTAGG + Intronic
963920007 3:150896409-150896431 GGTGAGCTAGTGTAACTTTCTGG + Intronic
965180262 3:165393731-165393753 GGACAGCTAGAAGTACTTCCAGG - Intergenic
965676961 3:171207594-171207616 GGAGAGCAAGGGGGACTTCCAGG + Intronic
967229248 3:187321937-187321959 AGGGAGTCAGTAGGACTTCCTGG - Intergenic
968720640 4:2200818-2200840 GGTGAGCTAGTATGATTTTTTGG - Intronic
972237439 4:37150514-37150536 GGTGAGCTTCTAAGACTTGCTGG - Intergenic
975472718 4:74789053-74789075 ACTGACCTAGAAGGACTTCCTGG + Intronic
981135160 4:141202330-141202352 AGAGAGCTAGGAGAACTTCCTGG + Intronic
986318823 5:6610933-6610955 GGTGAGCTGGTGGGGCCTCCAGG - Exonic
987394737 5:17412447-17412469 GGTGATGTGGTAGGACTGCCTGG - Intergenic
987577832 5:19753132-19753154 GGTAAGCTAGTAGGATTTTTGGG - Intronic
989027397 5:37083382-37083404 GGTGAGCTAGTGTGATTTTCTGG - Intergenic
996495202 5:124147955-124147977 GGTGAGCTAGTATGATCTCCTGG + Intergenic
1000945717 5:167420450-167420472 GGTGAGGTCATAGAACTTCCAGG - Intronic
1001166733 5:169375170-169375192 GGTGAGCTAGTGTGATTTTCTGG - Intergenic
1002158640 5:177302284-177302306 GGTGCTCTAGGAGGTCTTCCTGG - Intronic
1002674538 5:180900216-180900238 GGTGAGGCAGCAGGACATCCTGG + Intronic
1004152186 6:13132215-13132237 GATGAACTAGTGGCACTTCCTGG + Intronic
1006903682 6:37518889-37518911 GGGGATCTAGGAAGACTTCCTGG - Intergenic
1010817456 6:80375688-80375710 GGTGAGCTAGTATGATCTCTTGG + Intergenic
1010955424 6:82085733-82085755 GGTAAGATATTAGGAGTTCCAGG - Intergenic
1015507020 6:133999291-133999313 CGTGAGCTAGGAGGCCCTCCAGG + Intronic
1016544230 6:145202541-145202563 GGAGAGCTATTTGGACCTCCAGG + Intergenic
1018970596 6:168526048-168526070 GATAAGCTAGGAGGCCTTCCTGG + Intronic
1019736193 7:2650891-2650913 GCGGAGCTGGCAGGACTTCCCGG + Intronic
1024692463 7:51817974-51817996 TGTGAGTTAGAAGGACTTCAGGG + Intergenic
1028197860 7:87927566-87927588 GGTGAGCTGGTATGATTTTCTGG - Intergenic
1029221707 7:98995397-98995419 GGTGAGCCAGTAGGATTTATAGG + Intronic
1029277758 7:99417702-99417724 GGAGAGCCAGCAGGACATCCAGG - Exonic
1029290866 7:99501204-99501226 GTGAAGCTAGTTGGACTTCCTGG + Intronic
1029820691 7:103143653-103143675 GGAGAGCCAGAAGGACTTCAGGG + Intronic
1032695414 7:134331589-134331611 GATGAGCTTGGAAGACTTCCTGG - Intergenic
1037773513 8:21817432-21817454 GCTGATCTAGGAGGGCTTCCAGG - Intergenic
1037832408 8:22197239-22197261 GGTGTGCAAGTACGACTTCGTGG + Exonic
1037940063 8:22944572-22944594 GGTTAGTTAGGAGGACTTGCTGG - Intronic
1038697633 8:29819958-29819980 GGTGAGGTGGGAGGATTTCCAGG - Intergenic
1042201741 8:66285387-66285409 GGAGAGAGAGGAGGACTTCCTGG + Intergenic
1048792091 8:138113449-138113471 GGTCAGCTGGGAGAACTTCCTGG + Intergenic
1049341352 8:142114270-142114292 GGTGAGCCAGGAGGTCTCCCGGG + Intergenic
1049752718 8:144292860-144292882 GCTGAGATAGGAGGACTCCCTGG + Intronic
1049897987 9:128713-128735 GGTGAGCTAGTGGGATTTTTTGG + Intronic
1054158367 9:61656650-61656672 GGCGAGGTAGGAGGACTCCCAGG - Intergenic
1054478140 9:65587655-65587677 GGTGAGGTAGGAGGACTCCCAGG - Intergenic
1056510618 9:87301509-87301531 GGTGAGAGAGTAGGACAGCCAGG - Intergenic
1059337700 9:113579569-113579591 GGTGAGCAAGCTGGTCTTCCTGG + Intronic
1059421807 9:114196882-114196904 GGTGCTCCAGGAGGACTTCCTGG - Intronic
1186812346 X:13202664-13202686 GCTGACCTAGTAGGACTTAATGG - Intergenic
1190427917 X:50349811-50349833 GGTAAGCTATTTGGGCTTCCAGG + Intronic
1192008354 X:67241283-67241305 GGTGAGCCACTAAGACTTTCTGG + Intergenic
1196948172 X:120849626-120849648 GGTGAGCTAGTATGATTTTTTGG + Intergenic