ID: 1178831455

View in Genome Browser
Species Human (GRCh38)
Location 21:36060326-36060348
Sequence AGGTGAGCTAGTAGGACTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831455_1178831470 28 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831470 21:36060377-36060399 GGCTGCAGTGGGCGGGCCCAAGG 0: 1
1: 0
2: 2
3: 45
4: 408
1178831455_1178831469 21 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831455_1178831461 4 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831461 21:36060353-36060375 GCCGGCGGCCGCTTCCAAGATGG 0: 1
1: 0
2: 3
3: 21
4: 213
1178831455_1178831463 7 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831463 21:36060356-36060378 GGCGGCCGCTTCCAAGATGGAGG 0: 1
1: 0
2: 57
3: 222
4: 270
1178831455_1178831468 20 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831455_1178831465 16 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831465 21:36060365-36060387 TTCCAAGATGGAGGCTGCAGTGG 0: 1
1: 0
2: 5
3: 35
4: 369
1178831455_1178831466 17 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831466 21:36060366-36060388 TCCAAGATGGAGGCTGCAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831455 Original CRISPR AGGTGAGCTAGTAGGACTTC CGG (reversed) Intronic
902822006 1:18949170-18949192 CTGTGAGCTAGTAGGCCTCCAGG - Intronic
906053863 1:42899313-42899335 TGGTGAGCTAGTGTGACTTTTGG + Intergenic
906239997 1:44236979-44237001 AGAAGAGCAAGTAGGACTCCTGG - Intronic
922596980 1:226821635-226821657 AGGAAAGCCAGGAGGACTTCAGG + Intergenic
923759785 1:236831365-236831387 AGGTAAGCCAGGTGGACTTCTGG - Intronic
1067787534 10:49261360-49261382 AGAGGAGCTAAGAGGACTTCAGG + Intergenic
1069702801 10:70438986-70439008 AGGTGGGCCAGGAGGACATCAGG - Intronic
1075426141 10:122343187-122343209 AGGTGAGCCAGAAGGGCATCAGG - Intergenic
1079379466 11:19924868-19924890 AGGAGACCTAATAAGACTTCAGG + Intronic
1086126725 11:83356312-83356334 AGGTGAGAGGGTAGGACTTTAGG - Intergenic
1093413939 12:18898711-18898733 AGGAGAGCTTGTAGGAGTCCTGG + Intergenic
1093767290 12:22979519-22979541 AGGTCAGGAAGGAGGACTTCTGG + Intergenic
1095744918 12:45647247-45647269 AAGTGAGATAGCAGGGCTTCTGG + Intergenic
1103318792 12:120078078-120078100 AGGTGAGAGAGAAGGCCTTCTGG - Intronic
1104761484 12:131299713-131299735 AGATGAGCTCGTAGGCGTTCGGG + Intergenic
1104818292 12:131661079-131661101 AGATGAGCTCGTAGGCGTTCGGG - Intergenic
1114689965 14:24572365-24572387 GGGAGAGAGAGTAGGACTTCAGG + Intergenic
1116903035 14:50379646-50379668 AGGTGAGATAGAAGGACAGCTGG + Intronic
1119510116 14:75204551-75204573 AGGTGGGCGAATAGGACTTACGG + Intergenic
1121614924 14:95307334-95307356 ACCTGACCCAGTAGGACTTCTGG + Intronic
1121757076 14:96412181-96412203 AGGTGAGCTGCAAGGACTCCTGG + Intronic
1121773320 14:96572379-96572401 AGGTGAGCTGCAAGGACTCCTGG + Intergenic
1121865037 14:97354987-97355009 AGGTGAGCTAGTGGTGCCTCAGG - Intergenic
1123153703 14:106205322-106205344 AGGTGAGCAAGAAGGTCTGCAGG + Intergenic
1125318506 15:38457875-38457897 AGGTCAGATAGTAGGAGTTTTGG - Intronic
1127281070 15:57493626-57493648 GCATGAGTTAGTAGGACTTCTGG + Intronic
1128155019 15:65386522-65386544 AGGGGAGCCAGTCTGACTTCAGG - Intronic
1130149850 15:81303209-81303231 AAGTCAGGTTGTAGGACTTCAGG - Intronic
1130605838 15:85315890-85315912 AGGAGATCTAGCAGGACCTCAGG + Intergenic
1133645362 16:7759263-7759285 AGGTGTAATAGTAGGAATTCGGG + Intergenic
1140163408 16:72523481-72523503 AAGTGATCTGATAGGACTTCTGG - Intergenic
1140256378 16:73340053-73340075 AGGTGAGCAAGTAGAACTCTGGG + Intergenic
1140737345 16:77910132-77910154 AGGGAATCAAGTAGGACTTCAGG - Intronic
1141628903 16:85276317-85276339 AACTGAGGTAGGAGGACTTCAGG + Intergenic
1144099489 17:11931296-11931318 ATGTGAGCTGGCAGGGCTTCTGG - Intronic
1145882212 17:28360570-28360592 AGGTGAGGTACTAGGAGATCAGG + Exonic
1147414433 17:40278355-40278377 AGGTGAGCTGGGAGGACATTTGG - Exonic
1149309904 17:55383594-55383616 AGGTCAGCCAGGATGACTTCAGG + Intergenic
1153328305 18:3845211-3845233 AGGTAAGCTAATAGCAATTCTGG - Intronic
1155514841 18:26614326-26614348 AGGTGAGCTTCTTGGAATTCGGG - Intronic
1162125984 19:8499760-8499782 AGGAGAGCCATCAGGACTTCCGG - Exonic
1164063724 19:21696289-21696311 AGGTGAGCAAGGAGGACTGCAGG + Intergenic
1165259387 19:34599034-34599056 AGGTGAGCTGGGAGGAGTGCAGG - Intronic
1165272586 19:34723641-34723663 AGGTGAGCAAGGAGGTCTGCGGG - Intergenic
1167505144 19:49867323-49867345 AGGCGAGCGGGTGGGACTTCCGG - Intronic
1202641588 1_KI270706v1_random:95905-95927 ATGTGACCTTGTAGGCCTTCAGG + Intergenic
925298778 2:2795442-2795464 AGGTGATGTAGGAGGACCTCTGG - Intergenic
930028649 2:47045030-47045052 AGGTGGGCTGGTAGAACCTCCGG + Intronic
933621746 2:84551058-84551080 AGGTGAGCATGTAGGTATTCTGG - Intronic
935292021 2:101619062-101619084 AGCTGAGCTGGGAGGACTGCTGG - Intergenic
935402871 2:102678953-102678975 AGGTGAGGTGGTTTGACTTCAGG + Intronic
937824136 2:126346178-126346200 TGGTGAGCTGGCTGGACTTCAGG - Intergenic
939481172 2:142748766-142748788 AGGTGCCCCAGTGGGACTTCTGG + Intergenic
939886893 2:147690908-147690930 ACCTGAGCTAGCAGGACTTGGGG - Intergenic
940507555 2:154576370-154576392 AGGTGAGCAAGAAGGTCTGCAGG + Intergenic
940514571 2:154665867-154665889 AAGTGAGTTAGTAGGGTTTCTGG + Intergenic
945452806 2:210013410-210013432 AGGTGAGGTGGGAGGACTGCTGG - Intronic
948891750 2:240910160-240910182 GGGTGAGCAAGTCGGACTTGGGG + Intergenic
1171888711 20:30686108-30686130 ATGTGATCTTGTAGGGCTTCAGG + Intergenic
1175855493 20:62118755-62118777 AGCTTTGCTAGGAGGACTTCCGG - Intergenic
1178831455 21:36060326-36060348 AGGTGAGCTAGTAGGACTTCCGG - Intronic
1179810895 21:43868720-43868742 AGGTCAGCTAATAGGACATGAGG - Intronic
1180360357 22:11885969-11885991 ATGTGACCTTGTAGGCCTTCAGG - Intergenic
949284899 3:2390582-2390604 AGGTAAGCTAGTAGAGCTTATGG + Intronic
956301288 3:67775238-67775260 AGGAGAGCCAGCCGGACTTCGGG - Intergenic
956559558 3:70559800-70559822 AGGTGAGGCAGTAAGGCTTCTGG - Intergenic
956950369 3:74274758-74274780 TGGTGAGCTAGTATGATTTTTGG - Intronic
957888147 3:86317584-86317606 GCATGAGCAAGTAGGACTTCAGG - Intergenic
960173314 3:114488237-114488259 AGGTGGCCTTGGAGGACTTCAGG + Intronic
960428064 3:117533531-117533553 ATGTAAGATAGTTGGACTTCAGG - Intergenic
961559705 3:127720185-127720207 AGGTGAGATAGTAGGTCATGGGG - Intronic
962941337 3:140127272-140127294 AGGTGAGAAAGTAGAAGTTCAGG - Intronic
967011288 3:185437160-185437182 AGGTGAGGAGGTAGGACTGCAGG + Intronic
971528498 4:27653821-27653843 AAGAGATCTAGTAGGAATTCGGG + Intergenic
973385100 4:49506424-49506446 AAGTGACCTTGTAGGCCTTCAGG + Intergenic
974737700 4:65959564-65959586 AGGTGAGCTAGTAGCCCTGGAGG - Intergenic
982047571 4:151464124-151464146 AGGTGAGGCAGGAGGACTGCTGG - Intronic
1202768958 4_GL000008v2_random:181766-181788 ATGTGACCTTGTAGGCCTTCAGG + Intergenic
987577833 5:19753133-19753155 TGGTAAGCTAGTAGGATTTTTGG - Intronic
990211353 5:53483432-53483454 AGGTCAGCCAGGAGGGCTTCGGG - Intronic
995118117 5:108504863-108504885 AGGTAACCCAGAAGGACTTCAGG - Intergenic
998045585 5:138984166-138984188 AGCTGTGCTTGCAGGACTTCAGG + Intronic
1002617981 5:180467363-180467385 AGGTGAGCTGGAAGGACTAATGG + Intergenic
1003445783 6:6182902-6182924 AGATGATCTAGGAGGAATTCAGG + Intronic
1003930376 6:10919110-10919132 TGGTGAGCTAGTATGATTTTTGG + Intronic
1005739147 6:28774652-28774674 AGGTGAGCAAGGAGGTCTGCAGG + Intergenic
1011655974 6:89552387-89552409 AGGGGGACTAGGAGGACTTCAGG - Intronic
1012854248 6:104482731-104482753 AGGTGAACTAGAAGAACTTTGGG - Intergenic
1021539234 7:21738476-21738498 AGGTGAGGTGGAATGACTTCTGG + Intronic
1022359482 7:29644485-29644507 AGGTGAGCAAGGAGGTCTGCAGG + Intergenic
1024252155 7:47514300-47514322 AGGTGCAGTATTAGGACTTCAGG - Intronic
1024692462 7:51817973-51817995 TTGTGAGTTAGAAGGACTTCAGG + Intergenic
1026736676 7:72953490-72953512 AGGTGAGCTGGAAGGAGTTGAGG - Intergenic
1027107058 7:75411573-75411595 AGGTGAGCTGGAAGGAGTTGAGG + Intergenic
1028494184 7:91445679-91445701 AGGTAAGGTAGTAGGACATGAGG - Intergenic
1029694452 7:102203843-102203865 AGGTGAGCTGGTGGGACCTGGGG - Intronic
1029820690 7:103143652-103143674 AGGAGAGCCAGAAGGACTTCAGG + Intronic
1031238729 7:119211254-119211276 AGGTGGGCTCCTAGGACTTTGGG - Intergenic
1034348270 7:150400143-150400165 AGCTGTGCTGGTAGGACTTGGGG + Intronic
1037832838 8:22199265-22199287 AGGGGAGCTATTTGGACTTTTGG + Intronic
1039503488 8:38034666-38034688 AGGTGAGCAGGTAGGGCTGCAGG + Intronic
1044561946 8:93620845-93620867 AGTTGAGCTAGTAACACTCCTGG + Intergenic
1047251472 8:123184525-123184547 AGCTGGGCTGGTAGGATTTCAGG + Intronic
1049287807 8:141786000-141786022 AGGAGAGCTGGGAGGACTCCAGG + Intergenic
1049341351 8:142114269-142114291 AGGTGAGCCAGGAGGTCTCCCGG + Intergenic
1049375121 8:142285721-142285743 ACGTGGGCCAGGAGGACTTCGGG + Intronic
1053659729 9:40261111-40261133 ATGTGACCTTGTAGGCCTTCAGG - Intronic
1053910100 9:42890464-42890486 ATGTGACCTTGTAGGCCTTCAGG - Intergenic
1054360738 9:64113860-64113882 ATGTGACCTTGTAGGGCTTCAGG - Intergenic
1054371857 9:64407407-64407429 ATGTGACCTTGTAGGCCTTCAGG - Intronic
1054524869 9:66115106-66115128 ATGTGACCTTGTAGGCCTTCAGG + Intronic
1054679476 9:67897121-67897143 ATGTGACCTTGTAGGCCTTCGGG - Intronic
1058784755 9:108376258-108376280 AGGAGAGCCAGCAGGACTTTAGG - Intergenic
1061790974 9:133058673-133058695 AGGGCAGCTAGGAGGACTCCAGG + Intergenic
1061871561 9:133523476-133523498 AGGTGAGCAAGGAAGGCTTCGGG + Intronic
1203693850 Un_GL000214v1:75510-75532 ATGTGACCTTGTAGGGCTTCAGG + Intergenic
1203558303 Un_KI270744v1:23890-23912 ATGTGACCTTGTAGGGCTTCAGG + Intergenic
1203642423 Un_KI270751v1:28553-28575 ATGTGACCTTGTAGGGCTTCAGG - Intergenic
1186361910 X:8851159-8851181 AAGTGAGCAAGTAGGAATTATGG - Intergenic
1187333913 X:18365270-18365292 AGTTGAGGCAGGAGGACTTCTGG - Intergenic
1191680542 X:63835718-63835740 AGGAGAGCTAGAAAGACTTTAGG + Intergenic
1192122996 X:68474811-68474833 AGATGAGCTAGTTGAATTTCAGG + Intergenic
1193122495 X:77838354-77838376 AGCTGAGGCAGTAGGACTGCTGG + Intronic
1194933120 X:99913335-99913357 AGGTGAGTTTTTAGGACCTCTGG + Intergenic
1201715237 Y:17037377-17037399 AGATAATATAGTAGGACTTCTGG - Intergenic
1201909721 Y:19121644-19121666 AGTGGAGCCAGTTGGACTTCTGG - Intergenic