ID: 1178831457

View in Genome Browser
Species Human (GRCh38)
Location 21:36060334-36060356
Sequence CGGCGCCTAGGTGAGCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831457_1178831466 9 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831466 21:36060366-36060388 TCCAAGATGGAGGCTGCAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 533
1178831457_1178831461 -4 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831461 21:36060353-36060375 GCCGGCGGCCGCTTCCAAGATGG 0: 1
1: 0
2: 3
3: 21
4: 213
1178831457_1178831468 12 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831457_1178831463 -1 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831463 21:36060356-36060378 GGCGGCCGCTTCCAAGATGGAGG 0: 1
1: 0
2: 57
3: 222
4: 270
1178831457_1178831465 8 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831465 21:36060365-36060387 TTCCAAGATGGAGGCTGCAGTGG 0: 1
1: 0
2: 5
3: 35
4: 369
1178831457_1178831470 20 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831470 21:36060377-36060399 GGCTGCAGTGGGCGGGCCCAAGG 0: 1
1: 0
2: 2
3: 45
4: 408
1178831457_1178831469 13 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831457_1178831471 27 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831471 21:36060384-36060406 GTGGGCGGGCCCAAGGCACGTGG 0: 1
1: 0
2: 0
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831457 Original CRISPR CGGCGCCTAGGTGAGCTAGT AGG (reversed) Intronic
900161684 1:1227085-1227107 CGGAGCACAGGTGAGCTGGTGGG - Intronic
904775013 1:32901210-32901232 CTGCGCCTCGGTGAGCGACTGGG - Exonic
911645237 1:100330636-100330658 CAGGGCCCAGGTGAGCCAGTGGG - Intergenic
920203842 1:204277241-204277263 GGTCGCCTAGGTGCCCTAGTAGG + Intronic
922775410 1:228212225-228212247 CGGCGCCTGGGTGAGCCCGACGG + Exonic
1114847567 14:26341829-26341851 GTGCGCGTAGGTGAACTAGTTGG - Intergenic
1119561684 14:75595272-75595294 TGGCCCCTAGGTTAACTAGTTGG + Intronic
1132050761 15:98606003-98606025 TGACTGCTAGGTGAGCTAGTTGG + Intergenic
1148200266 17:45745580-45745602 AGGCTCCTTGGTGAGCCAGTGGG + Intergenic
1152303751 17:79509633-79509655 CGGCGCCTGGGAGAGCTATGAGG + Intronic
1167796587 19:51713507-51713529 CGGCGCCTACGTGGGCTACTGGG - Exonic
946753609 2:222919629-222919651 CCATGCCTAGGTGTGCTAGTTGG - Intronic
1178831457 21:36060334-36060356 CGGCGCCTAGGTGAGCTAGTAGG - Intronic
957209321 3:77239719-77239741 CTGCGTCTAGGTAATCTAGTGGG - Intronic
985957260 5:3275023-3275045 CGGCCCCTACGTGAGCTACAGGG + Intergenic
1006122287 6:31814876-31814898 GGGAGACTAGGTGAGCCAGTAGG - Exonic
1023177597 7:37448620-37448642 CCGCGCCGAGGTCAGCGAGTCGG + Intronic
1039060297 8:33567091-33567113 CGGCGCAGAGGTGAGCTGGCTGG + Exonic
1040755758 8:50772099-50772121 CAATGCCTAGGTGAGCTACTGGG + Intronic
1040915953 8:52565975-52565997 CTGCGCCTAGGAGAGCAGGTCGG - Intergenic