ID: 1178831460

View in Genome Browser
Species Human (GRCh38)
Location 21:36060346-36060368
Sequence GGAAGCGGCCGCCGGCGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831460_1178831468 0 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831460_1178831470 8 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831470 21:36060377-36060399 GGCTGCAGTGGGCGGGCCCAAGG 0: 1
1: 0
2: 2
3: 45
4: 408
1178831460_1178831466 -3 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831466 21:36060366-36060388 TCCAAGATGGAGGCTGCAGTGGG 0: 1
1: 0
2: 3
3: 51
4: 533
1178831460_1178831465 -4 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831465 21:36060365-36060387 TTCCAAGATGGAGGCTGCAGTGG 0: 1
1: 0
2: 5
3: 35
4: 369
1178831460_1178831469 1 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831460_1178831471 15 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831471 21:36060384-36060406 GTGGGCGGGCCCAAGGCACGTGG 0: 1
1: 0
2: 0
3: 13
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831460 Original CRISPR GGAAGCGGCCGCCGGCGCCT AGG (reversed) Intronic
900189978 1:1349215-1349237 GGGGGCGGCGGCCGGGGCCTGGG - Intronic
900414684 1:2529550-2529572 GGGCGCGGCGCCCGGCGCCTTGG + Exonic
900984616 1:6066154-6066176 GGAAGCGGCCTCGGGAGCCCAGG - Intronic
901075917 1:6554592-6554614 GGCAGAGGGCGCCGGCGGCTCGG - Intergenic
901109633 1:6784920-6784942 GGAAGCCGCTGCTGGCGCGTGGG - Intergenic
901332750 1:8423682-8423704 GGAGGCGGCCGCGGGTGGCTCGG + Intronic
901658811 1:10786127-10786149 GGCAGAGGCCACTGGCGCCTTGG + Intronic
901886893 1:12229928-12229950 AGGAGCGGCCGCCGGCGCCAGGG + Intergenic
902169594 1:14599147-14599169 GGGAGCCGCGGCCAGCGCCTCGG + Exonic
902870646 1:19311950-19311972 GGACGCGCCCGCCAGCGCCGCGG - Exonic
902940872 1:19799677-19799699 GGAAGCGGCCGCGCGCTCCCTGG - Intronic
908355781 1:63323841-63323863 GGCGGCGGCGGCCGGCGCCGCGG + Exonic
910237341 1:85048756-85048778 CGGAGCTGCCGCCGGCGCCGGGG + Intronic
915561910 1:156692658-156692680 GGAAGGGGCCGCCTGCAGCTGGG + Intergenic
915581399 1:156815192-156815214 GGAGGCAGCCTCCGGGGCCTGGG + Exonic
915935796 1:160089668-160089690 GGAAGCTGCCGCTGGTGACTGGG - Exonic
916033020 1:160894928-160894950 GGGAGCGGCCGCGGGAGACTGGG - Intergenic
916750921 1:167722154-167722176 GGCAGCGTCCGCCGGAGCCGGGG + Exonic
917345182 1:174022158-174022180 GGCAGCCGCCGCCGCCGCCGAGG + Exonic
917978525 1:180255138-180255160 GGAGGCGGCAGCCCGCGCCTGGG + Intronic
918040623 1:180912291-180912313 GGAATTGCCCGCCGCCGCCTTGG - Intergenic
923126624 1:231039777-231039799 GGAGGACGGCGCCGGCGCCTGGG + Intronic
923140834 1:231160981-231161003 GGAAGCTGCAGCCTGCGCCCAGG - Intergenic
1064230786 10:13528450-13528472 GTAAGCGGCCGCCGGGGCGGCGG - Intronic
1071676385 10:87659718-87659740 GGACCCGGCCGCCGCCGCCTAGG - Exonic
1072189485 10:93068448-93068470 GGAAGCGGCTGGAGGCGCCCCGG - Exonic
1072891675 10:99329975-99329997 GGAAGCCGCCGGCGGCGCCGTGG - Exonic
1075768844 10:124916931-124916953 GGAGGCGGCCGCGGGCGCTGCGG - Intergenic
1076793332 10:132787710-132787732 GGGCGCGGGCGCCGTCGCCTTGG - Intergenic
1077501511 11:2911613-2911635 GGAGGCGGCAGCAGGCGGCTGGG - Intronic
1077877502 11:6320420-6320442 GGGACCCCCCGCCGGCGCCTCGG + Exonic
1078334097 11:10450628-10450650 GGAAGCACCCGCCGCCTCCTGGG - Intronic
1079251575 11:18791393-18791415 GGGGGCGGGCGCCGGCTCCTCGG + Intronic
1079591887 11:22192498-22192520 GGAAGGGGCTGCTGGCACCTTGG + Intergenic
1081807328 11:45897639-45897661 TGAGGCTGCTGCCGGCGCCTCGG + Intronic
1083365761 11:62140678-62140700 TGATGCCGCCGCCCGCGCCTTGG + Intronic
1084516814 11:69642031-69642053 GGGAGCGGCCGCCGGGCGCTGGG + Intronic
1089432559 11:118436261-118436283 GGAGGCGGCGGCCCGGGCCTCGG + Intergenic
1090834774 11:130446444-130446466 GGAAGCGCCCCCTGGGGCCTTGG - Intergenic
1091616471 12:2053969-2053991 GGCAGAGGGCGCCGGCGCCGCGG + Intronic
1098331671 12:69359940-69359962 GGAAGAAGCCGCCGCCGCCAGGG - Exonic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1100555967 12:95694309-95694331 GGGAGTGGCCGCCGGGGTCTTGG - Intronic
1101605856 12:106247486-106247508 GAAAGCGGCCGCCGCCACCAGGG + Exonic
1102277958 12:111598117-111598139 GGGAGCCCCCGCCGCCGCCTCGG + Intronic
1102807036 12:115791306-115791328 GGAATGGGCCGCCAGAGCCTGGG + Intergenic
1102853955 12:116277497-116277519 CGGAGCCGCCGCCGCCGCCTCGG + Intergenic
1103328113 12:120134949-120134971 GATAGCGGCCGCCGCCTCCTCGG - Intronic
1105725759 13:23160461-23160483 GGAAGTGGGCGCCCGCGGCTTGG + Intergenic
1111518212 13:89363179-89363201 GGAGGTGGCCGCCGGAGCCGGGG - Intergenic
1111951731 13:94713341-94713363 GGAAGGGGCCCCCTGCGCCGCGG - Intergenic
1112507199 13:99982138-99982160 GGCAGCCGCCGCCGCCGCCGCGG - Exonic
1113895099 13:113759268-113759290 GGATGCAGCCGCCGGTGCCCGGG + Exonic
1114417926 14:22556649-22556671 GGGAGGGGCTGCCGGCCCCTCGG + Exonic
1117353615 14:54903014-54903036 GGAAAAGGGCGCCGGCCCCTAGG + Intergenic
1117875893 14:60249620-60249642 GGCTGCCGCCGCCGCCGCCTCGG + Intronic
1122666680 14:103334713-103334735 GGAGGGGGCGGCCGGCGCCCGGG - Intronic
1124922304 15:34038886-34038908 GGAGGCGGACGCCGGGGCCGTGG - Exonic
1126483659 15:49155443-49155465 GGGAGAGGCCGCGGGCGCCCCGG + Intronic
1127674876 15:61229137-61229159 GGACGCGGCCGCCGGCTCCAGGG - Intronic
1128111095 15:65076777-65076799 GGAGGCTGCCGCTGGGGCCTTGG - Intergenic
1130352884 15:83107375-83107397 GCAAGCGCCCGGCGGCGCCGAGG - Intergenic
1131163683 15:90126978-90127000 GGAAGGGGCTGCCTGCTCCTAGG + Intergenic
1131367516 15:91853295-91853317 GGAGGCGGCGCCCGGCCCCTAGG - Intergenic
1132398005 15:101488873-101488895 AGCAGCGGCCGCGGCCGCCTTGG + Intronic
1132660378 16:1058382-1058404 GGATGCGGCAGCCGGGGGCTCGG - Intergenic
1132675657 16:1120341-1120363 GGACTCGGCCTCCAGCGCCTGGG - Intergenic
1136172765 16:28498379-28498401 GGAAGAGACCGCGGGCACCTGGG + Intronic
1136335145 16:29606045-29606067 TGAAAGTGCCGCCGGCGCCTGGG - Intergenic
1136365406 16:29807003-29807025 GGGCTCGGCCGCCGGGGCCTGGG - Exonic
1136455245 16:30376548-30376570 GGAAAAGGCAGCCGGGGCCTTGG - Intronic
1136498854 16:30659753-30659775 GGACGGGGCCGCCGGCGTCTCGG - Exonic
1136566407 16:31073309-31073331 GGAGGGGGCCGCCGGCGCCTGGG + Intronic
1141054584 16:80803932-80803954 GGGAGCGGGCGCGGGCGCCGCGG + Intronic
1141079201 16:81035951-81035973 AGGAGCCGCCGCCGCCGCCTCGG + Exonic
1141699802 16:85637186-85637208 GACAGCGGCCGCCGGGGGCTGGG - Intronic
1142247806 16:88977740-88977762 GGAGGCGGCCGCTGGGGCGTGGG - Intergenic
1142611144 17:1109656-1109678 GGAAGGGGGCTCCGGCGCATGGG - Intronic
1144756342 17:17682389-17682411 GGAAGCGGCCCCCGCGACCTGGG + Intronic
1146757729 17:35448399-35448421 GGAAGGTGTCGCCGGCGGCTTGG - Intronic
1147159447 17:38561881-38561903 TGTAGAGGCCGCCGGCGCCCGGG + Exonic
1147285740 17:39401576-39401598 CGTTGCGGCCGCCGGCGCCGCGG - Exonic
1147620777 17:41865271-41865293 GGAGACGGCCGCCGCCGGCTCGG - Exonic
1147666959 17:42154967-42154989 GGAAGTGGAGGCCGGAGCCTGGG - Exonic
1149997123 17:61411259-61411281 GGAACCCGCGGCCGGCGGCTGGG + Intergenic
1150840377 17:68601002-68601024 GGCAGCCGGCGCCGGCGCCCCGG - Exonic
1151708384 17:75784918-75784940 GGTAGCGGCCGGGGGCGCCGAGG - Exonic
1151854306 17:76710546-76710568 GGCAGCGGCAGCCGGAGCCCCGG + Intronic
1152111617 17:78360212-78360234 GGGAGGGGCCGCGGGCGCCGAGG + Intergenic
1152621334 17:81366350-81366372 GGAAGGTGCCGGCGGCTCCTGGG + Intergenic
1153382538 18:4455142-4455164 GCGAACGGCCGCCGCCGCCTCGG - Exonic
1153805545 18:8706109-8706131 GGCAGCGGCAGACGGCGGCTCGG - Intronic
1157566217 18:48680767-48680789 GGAAGGAGCCGCCGGGGCTTGGG + Intronic
1157764206 18:50285195-50285217 GGCAGTGGCCGGCGGGGCCTTGG + Exonic
1160864570 19:1251094-1251116 GGCGGCGGCCGCCTGCGCCGGGG + Intronic
1160967599 19:1753478-1753500 GGGAGCGGCCGCCGGCGCCCGGG - Exonic
1161003681 19:1924122-1924144 GGAAGCTTCCGCCAGCCCCTCGG - Exonic
1161063767 19:2227840-2227862 GCAGGCGGCGGCCAGCGCCTCGG + Intronic
1161607502 19:5222965-5222987 GGAGGCGGCCGGCAACGCCTCGG - Exonic
1162341894 19:10096296-10096318 GGCGGCGGCCGACGGCGCCGTGG - Exonic
1162907071 19:13830459-13830481 GGACGCGGCGGCCGGCGGCCTGG + Exonic
1163711337 19:18849036-18849058 GGAAGCAGCCGCTGGCCCTTAGG + Intronic
1163847029 19:19643614-19643636 CGCAGCCGCCGCCGCCGCCTCGG + Exonic
1165772337 19:38386815-38386837 TGAAGCCGCCGCCGCCGCCCCGG - Exonic
1165778367 19:38418028-38418050 CGAAGCGACCGCTGGGGCCTGGG + Intronic
1167074340 19:47239785-47239807 GGCAGCGGCGGGCGGGGCCTGGG - Intergenic
1167445138 19:49533329-49533351 GGAGGGGGCCGCGGGGGCCTAGG + Intronic
1167578330 19:50328317-50328339 GGACGCGGGCGGCGGCGCCGGGG - Exonic
1168553275 19:57317607-57317629 GGGAGCGGCCTCCGGCCCCGCGG - Intergenic
928904561 2:36356065-36356087 GGAAGCTGCCGCCGGCGCCAAGG + Exonic
929780276 2:44952768-44952790 GGCAGCGGTGGCCGGGGCCTGGG - Intergenic
932144682 2:69307054-69307076 GGAAGAGGCTGCAGGCGCCCGGG - Intergenic
932699849 2:73985058-73985080 GGCCGCCGCCGCCGCCGCCTGGG - Intergenic
935122867 2:100197745-100197767 GGACGCCGCCGCCTGCTCCTGGG + Intergenic
935622830 2:105144103-105144125 GGGAGCAGCCGGCGGCGCCGCGG + Intergenic
935973966 2:108559013-108559035 AGAAGCTGCCCCCGGCGCCTTGG - Intronic
936038198 2:109129179-109129201 GCAAGCGGCGGCTCGCGCCTGGG - Intergenic
939969618 2:148644820-148644842 GGAGGCGGCCGCGGGCGCGGGGG + Intronic
941666231 2:168246785-168246807 GGACGCGGCCCCCGGGGCCCTGG + Intronic
941930031 2:170929634-170929656 GGAGGCGGCTGCCGGCGACTCGG + Intronic
942240827 2:173963781-173963803 GGAGGCGGCCGCCGCAGCCGGGG - Exonic
945064826 2:205939872-205939894 GGAAGCGCCCACCGCCGTCTTGG + Intergenic
946248566 2:218400231-218400253 GGGAGCCGCCGCCGCCGCCCCGG + Intronic
947765195 2:232633462-232633484 GGAGGAGGCCGCCGGTGTCTGGG - Exonic
1169213110 20:3778520-3778542 GGGACCGGCCGCCGGCGCCTCGG - Exonic
1169216343 20:3796656-3796678 GGAAGCGGCCGCCCGCACCGGGG - Exonic
1170617804 20:17968481-17968503 GGCCGCCGCCGCCGCCGCCTGGG + Intronic
1171123100 20:22582380-22582402 GAAGGCGGCCGCCGGAGCCCAGG - Exonic
1175912758 20:62412631-62412653 GGAAGCGGGCCTCGGAGCCTGGG - Exonic
1176549182 21:8214127-8214149 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1176557075 21:8258348-8258370 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1176568114 21:8397165-8397187 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1176576017 21:8441385-8441407 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1178831460 21:36060346-36060368 GGAAGCGGCCGCCGGCGCCTAGG - Intronic
1183466705 22:37983794-37983816 GGCCGCCGCCGCCGCCGCCTCGG + Exonic
1183606982 22:38871841-38871863 GGCAGCGGGCACCGGGGCCTGGG - Intronic
1184207647 22:43015127-43015149 AGAAGCGGCCGCAGGGGTCTGGG - Exonic
1184651830 22:45922823-45922845 GGAGGCGGCCGCGGGCACCCTGG - Exonic
1184668247 22:45999762-45999784 GGACGCGCCCACCGGAGCCTGGG - Intergenic
1185338120 22:50279825-50279847 GGAAGGGGCCCCCGGAGCCCTGG + Intronic
1203254067 22_KI270733v1_random:130443-130465 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1203262123 22_KI270733v1_random:175522-175544 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
949414310 3:3799562-3799584 GGAAGGCGCCCCAGGCGCCTAGG - Exonic
950094510 3:10321087-10321109 GGCAGCTCCCGGCGGCGCCTCGG + Intronic
953656940 3:44861782-44861804 GGAATCGCTCTCCGGCGCCTCGG - Intronic
954806538 3:53224115-53224137 GGCAGCAGGCGCCGGGGCCTGGG - Intergenic
960628339 3:119703005-119703027 GGTAACGGCCGCCGGCGCGCAGG - Exonic
962809798 3:138950286-138950308 GGCAGAAGCCGCCCGCGCCTCGG + Exonic
962811170 3:138960604-138960626 GGAAGCGGCAGCCGGCGATGGGG + Intergenic
968048238 3:195635656-195635678 GGTCGCGGCCACCGGCTCCTGGG + Intergenic
968090573 3:195895977-195895999 GGAACCGGCCGCGGGGGCCTCGG - Intronic
968099166 3:195953964-195953986 GGTCGCGGCCACCGGCTCCTGGG - Intergenic
968306371 3:197654265-197654287 GGTCGCGGCCACCGGCTCCTGGG - Intergenic
968433983 4:575769-575791 GGGAGCGCCTGCCGGCGCCGCGG + Intergenic
968450648 4:674586-674608 GGACGCGGACGGCGGGGCCTCGG - Intronic
968729267 4:2262004-2262026 GGCAGCGGCCGCCGCCGTCCCGG - Exonic
968965203 4:3766109-3766131 AGGAGCGGCGGCCGGCGCCCCGG + Intergenic
975666791 4:76741085-76741107 GGAGGCGGAGGCCGACGCCTCGG - Exonic
975779059 4:77819925-77819947 GGCCGCGGCCGCCGGCGCGAAGG + Intergenic
976431241 4:84966002-84966024 GGGAGCCGCCGCCGCCGCCAGGG - Intronic
976475249 4:85475609-85475631 GGACGCGGCTGCCTGCGCCAGGG + Intronic
983923430 4:173371254-173371276 TGCCGCGGCCGCCGCCGCCTCGG + Exonic
984928313 4:184825835-184825857 GGCAACGTCAGCCGGCGCCTCGG + Intronic
985241758 4:187937822-187937844 GGAAGCAGCAGCAGGCGCGTGGG - Intergenic
985472491 5:54350-54372 GGAAGGGGCCGCCGTGGCCCGGG + Intergenic
985504729 5:272149-272171 GGTCGCGGCCACCGGCTCCTGGG + Intronic
985680118 5:1251759-1251781 GGGAGCGGCCCCGGGCGCCGTGG - Intergenic
985743385 5:1633447-1633469 GGTCGCGGCCACCGGCTCCTGGG - Intergenic
985805249 5:2038780-2038802 GGCAGCGGACGGCGGCGCCCAGG + Intergenic
988949332 5:36241656-36241678 GGTGGCGGCCGGCGGCACCTGGG - Exonic
989178990 5:38557150-38557172 GGACGCGAGCGGCGGCGCCTCGG - Intronic
990308671 5:54518084-54518106 GGAAGAGGCCGCGGTCGCCGCGG - Exonic
994043641 5:95284753-95284775 AGAAGCGGCCGCCGCCGCCGAGG + Intergenic
997377163 5:133405510-133405532 GGGAGCGGCAGCCCTCGCCTGGG + Intronic
999462943 5:151772299-151772321 GTAAGCCGCGGCCGCCGCCTGGG + Intronic
1002190135 5:177473595-177473617 GGGAGTCGCCGCCGCCGCCTCGG + Intronic
1002712146 5:181201843-181201865 TGAAGCTGCCGCCGGTGCCAGGG + Intronic
1006300959 6:33193306-33193328 GCCAGCGGGCGGCGGCGCCTCGG - Intergenic
1007783208 6:44265642-44265664 GGAAGCGCCCGCCGGGGGCGGGG - Exonic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1016010757 6:139135524-139135546 GCAACCGGCCGCCGCCGCCAGGG - Exonic
1019317020 7:391528-391550 GGGAGCGGCCGCCAGCCGCTAGG + Intergenic
1019451107 7:1098804-1098826 GGAAGCGGCTGCCGGGGCTGGGG + Intronic
1021884408 7:25124931-25124953 GGAAGAGGCCGCCTCCTCCTCGG + Intronic
1022363263 7:29684652-29684674 GGAAGCAGCCCCCGGCGCCCCGG + Intergenic
1022363509 7:29685582-29685604 AGCAGCGGCCGCCGGAGACTAGG - Intergenic
1022428062 7:30285925-30285947 GGAGGCAGCCCCCGGCGCCCCGG - Intronic
1022518013 7:30987983-30988005 GGAAGGGGCTGCAGGAGCCTGGG + Intronic
1022698122 7:32729108-32729130 GGAAGCAGCCCCCGGCGCCCCGG - Intergenic
1027786855 7:82590774-82590796 GGAAGCGGCTGCCATAGCCTGGG + Intergenic
1028761068 7:94497075-94497097 GCAAGCGGGTGCCGGGGCCTGGG + Intergenic
1029620690 7:101688362-101688384 GGAAGGGGCCGCCCTGGCCTCGG - Intergenic
1029708437 7:102287195-102287217 GAGAGCGGCCGCACGCGCCTTGG + Intronic
1033033149 7:137846557-137846579 GGCAGCGGCCCCCGCCGCCGCGG + Exonic
1035074300 7:156168470-156168492 GGAAGGGGCCGCGGGCTCCCCGG - Intergenic
1035284506 7:157797582-157797604 GGAGGCGGCCACAGGCTCCTGGG + Intronic
1036310243 8:7680146-7680168 AGAAGCGGCAGCTGGCGTCTCGG + Intergenic
1036359292 8:8065957-8065979 AGAAGCGGCAGCTGGCGTCTCGG - Intergenic
1036891665 8:12600995-12601017 AGAAGCGGCAGCTGGCGTCTCGG + Intergenic
1037825215 8:22156559-22156581 GGCCGCGGCCGCCGGCCCCAGGG - Exonic
1041732659 8:61077917-61077939 GGAAGGGGGCTCCGGCTCCTCGG + Intronic
1042241274 8:66666860-66666882 CGAAGCAGCCGCCGACGCCAAGG + Exonic
1043502644 8:80873313-80873335 GAAAGCGGGAGCCGCCGCCTGGG + Intronic
1044698911 8:94949187-94949209 GGGAGCGGCCGCCGGCTCGGCGG + Exonic
1045510128 8:102807096-102807118 GGAAGCGGCCGCCGGCTGCTGGG - Intergenic
1049463024 8:142738897-142738919 GGGAGCGGCGGCCTGGGCCTGGG - Intergenic
1049643995 8:143727969-143727991 GGAAGCGGGGCCCGGCGCCCAGG + Exonic
1049728154 8:144160872-144160894 GGAAGCAGCCCCCGGCGCCTGGG - Intronic
1053372726 9:37576242-37576264 GGCCGCGGCCGCCGGTGCCCTGG + Exonic
1060220053 9:121759755-121759777 GGAGGCGGCAGCGGGCGCCTAGG - Intronic
1061005853 9:127928111-127928133 GGTAGGGGCCGCCGGGGCCCAGG + Exonic
1062325698 9:136011552-136011574 GGCCGCGGCCGCCGGCGTCTGGG + Exonic
1203470468 Un_GL000220v1:113587-113609 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1203478289 Un_GL000220v1:157559-157581 GGTAGCGGCCCCCGGCGCGCCGG + Intergenic
1187697990 X:21940502-21940524 GGGAGCGGCCGCGCGAGCCTTGG + Intergenic
1188005490 X:25013526-25013548 GGCCGCGGCCGCCGCGGCCTGGG - Exonic
1191054965 X:56232250-56232272 GGAGGCGGCCGCCGGAGGCGAGG + Intergenic
1198807172 X:140504067-140504089 TGCCGCGGCCGCCGCCGCCTCGG - Exonic
1199984630 X:152941803-152941825 GGAAGGGGCAGCCAGCTCCTCGG - Intronic
1199997186 X:153032853-153032875 GGAAGGGGCAGCCAGCTCCTCGG - Intergenic