ID: 1178831462

View in Genome Browser
Species Human (GRCh38)
Location 21:36060354-36060376
Sequence TCCATCTTGGAAGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831462_1178831469 -7 Left 1178831462 21:36060354-36060376 CCGGCGGCCGCTTCCAAGATGGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831462_1178831471 7 Left 1178831462 21:36060354-36060376 CCGGCGGCCGCTTCCAAGATGGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1178831471 21:36060384-36060406 GTGGGCGGGCCCAAGGCACGTGG 0: 1
1: 0
2: 0
3: 13
4: 169
1178831462_1178831468 -8 Left 1178831462 21:36060354-36060376 CCGGCGGCCGCTTCCAAGATGGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1178831468 21:36060369-36060391 AAGATGGAGGCTGCAGTGGGCGG 0: 1
1: 1
2: 33
3: 442
4: 2987
1178831462_1178831470 0 Left 1178831462 21:36060354-36060376 CCGGCGGCCGCTTCCAAGATGGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1178831470 21:36060377-36060399 GGCTGCAGTGGGCGGGCCCAAGG 0: 1
1: 0
2: 2
3: 45
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831462 Original CRISPR TCCATCTTGGAAGCGGCCGC CGG (reversed) Intronic
900244445 1:1630871-1630893 TCCGTCCTGGGGGCGGCCGCGGG + Intergenic
913512424 1:119573868-119573890 GCCATCTTGGAAGTGACCACTGG - Intergenic
1068062666 10:52088626-52088648 GCCATCTTGGAAGCAGATGCTGG + Intronic
1069629701 10:69890058-69890080 TCCATCTGGGTGGTGGCCGCGGG - Intronic
1070138354 10:73715614-73715636 TCCCTCCTGGAAGGGGCGGCTGG + Intergenic
1070711369 10:78685476-78685498 CCCATCCTGGAAGTGGCTGCTGG - Intergenic
1076843351 10:133057283-133057305 TCCAGGTTGGAAGGGGCCGTGGG - Intergenic
1081180795 11:39984005-39984027 GCCATCTTGGAACCTCCCGCCGG - Intergenic
1084549225 11:69830969-69830991 TCCATCTGGGAAGATGCCCCAGG + Intergenic
1088057230 11:105599153-105599175 TCCATCTGGTAAGTGACCGCAGG + Intergenic
1089556021 11:119316407-119316429 CCCATACTGGAAGCGCCCGCTGG - Intronic
1090621564 11:128565308-128565330 TCCATCTTGGAAGCTGAGACGGG + Intronic
1090755869 11:129791166-129791188 TTTATCTTGGAAGCAGCAGCTGG + Intergenic
1099554675 12:84097142-84097164 TCCATCTTGCCAGCTGCCCCAGG - Intergenic
1106502717 13:30344988-30345010 TCCATCTTGGTGGGGGCGGCAGG - Intergenic
1106884502 13:34169443-34169465 GCCATCTTGGAAGCAGAGGCTGG + Intergenic
1107411714 13:40164040-40164062 TCCATCGTGGAAGCAGGCTCAGG + Intergenic
1111985569 13:95063033-95063055 TTCATTTTGGAAGCTGCCCCAGG + Intronic
1113674571 13:112198519-112198541 GCCATCTTGGAAGCAGAGGCTGG - Intergenic
1113784760 13:112996658-112996680 TCCTTCTTGGATGCGCCCGATGG + Intronic
1118979884 14:70707695-70707717 GACATCTTGGAAGCATCCGCTGG - Intergenic
1118998417 14:70858783-70858805 TCCAGCTTGGAAGGGGCGGCTGG - Intergenic
1122515412 14:102304964-102304986 TTCATCTTGGATGCGGAAGCCGG + Exonic
1123125514 14:105943188-105943210 ACCATCTTGGAAGTGGCCTGCGG + Intergenic
1131445402 15:92494670-92494692 CCCATCTTGAAAGCGGCAGCAGG - Intronic
1135290939 16:21237514-21237536 ACCATCTTGGAAGCGGAGACAGG - Intronic
1138642211 16:58396151-58396173 TCCCTCTTGGACGGGGCGGCTGG + Intronic
1139364451 16:66425401-66425423 TCCATCCTGGAAGGGTCAGCAGG + Intergenic
1145920131 17:28604146-28604168 TCCCTCCTGGAAGGGGCGGCTGG + Intronic
1145962809 17:28897375-28897397 TCTCTCTTGGAAGGGGCCTCAGG + Intronic
1149349977 17:55776545-55776567 TCCAGCTTGGGAGGGGCTGCTGG + Exonic
1152252748 17:79220248-79220270 CCAATCAGGGAAGCGGCCGCTGG + Intronic
1152297421 17:79476129-79476151 TCCATCTGGGGAGCAGCGGCAGG + Intronic
1154253626 18:12765138-12765160 CCCTTCTTGGAAGCGGGTGCAGG - Intergenic
1155921546 18:31608252-31608274 ACCATCTTGGAAGCAGACACTGG + Intergenic
1160153760 18:76416225-76416247 TCCTCCTTGGAAGAGGCGGCCGG + Intronic
1160383867 18:78482055-78482077 TCCATCTGGGAGGCTGCGGCTGG + Intergenic
1161389993 19:4015821-4015843 TCCATCCTGGAGCCGGCCGGCGG - Intronic
1163317452 19:16550724-16550746 TCCATCTTGGCAGGGGGCGGGGG + Exonic
1166296473 19:41892490-41892512 TCCTTCTTGGCAGCGGCCTCAGG + Intronic
932496273 2:72147373-72147395 TCCATCTTGGGAGCCCCCTCAGG + Intronic
932672511 2:73750786-73750808 TCAATCTTGCAAGCCGCCCCTGG - Intergenic
941187183 2:162331611-162331633 GCCATCTTGGAAGCAGAGGCTGG + Intronic
943117709 2:183693617-183693639 ACCATCTTGGAAGCAGAGGCTGG - Intergenic
1171547061 20:26010650-26010672 TCCAGCTTGTAAGCGGCAGTGGG - Intergenic
1175069597 20:56322077-56322099 TCCCTCTTGCAAGCTGCCTCAGG - Intergenic
1175799389 20:61792424-61792446 TGCATCTTGGAAGAGGCCCTTGG - Intronic
1177127383 21:17212359-17212381 TTCATCTTGGAAGCAGAGGCTGG + Intergenic
1178831462 21:36060354-36060376 TCCATCTTGGAAGCGGCCGCCGG - Intronic
1181273945 22:21676996-21677018 TCCCTCTTGGACGGGGCGGCTGG + Intronic
1184548564 22:45190895-45190917 TCTATCTTGGAAGCTGCCTGCGG - Intronic
1185227191 22:49659832-49659854 TCAGTCTTGGAGGTGGCCGCAGG + Intergenic
950949146 3:16980287-16980309 TCCCTCTTGGACGGGGCGGCTGG + Intronic
951613911 3:24521702-24521724 TCCACCGTGGTCGCGGCCGCCGG + Intergenic
951870477 3:27356123-27356145 TCCATCTTGGAAGCAGGGACTGG + Intronic
954481284 3:50803804-50803826 TCCCTCCTGGAAGGGGCAGCTGG + Intronic
954481305 3:50803850-50803872 TCCATCCTGGACGGGGCGGCTGG + Intronic
956472082 3:69577766-69577788 GCCATCTTGGAACCGCCCCCAGG + Intergenic
956802075 3:72768866-72768888 TCAATTTTGGAAGCTGCAGCGGG - Intronic
970443453 4:16104906-16104928 TCCATCTTGGAAGCAGGAGGTGG - Intergenic
970496201 4:16628623-16628645 GCCATCTTGGAAGTGACCCCGGG - Intronic
975291135 4:72679331-72679353 GCCATCTTGGAAGTGACCTCTGG - Intergenic
975314139 4:72932467-72932489 ACCATCTTGGAAGCAGCCCGTGG - Intergenic
981454910 4:144941927-144941949 TCCATCTTCAAAGCTGCCTCAGG - Intergenic
983018516 4:162645037-162645059 TCCATTTTGGAAGGGGTGGCAGG - Intergenic
991290667 5:65031178-65031200 ACCATCTTGGAAGCGGCCTGCGG + Intergenic
992401527 5:76416348-76416370 AGCATCTTGGAAGCTGCCACTGG + Intronic
997321597 5:132983037-132983059 TCCCTCTCGGAAGGGGCGGCTGG + Intergenic
1001299667 5:170524619-170524641 TCCATCTTGGGACAGGCAGCAGG - Intronic
1005816709 6:29558905-29558927 ACCATCTTGGAAGCGGCCTGCGG + Intronic
1008673091 6:53793806-53793828 GCCAGCGTGGCAGCGGCCGCAGG + Intergenic
1018156675 6:160991775-160991797 GCCATCTTGGAAACGGCGACCGG - Exonic
1020809929 7:12839536-12839558 GCCATCTTGGAAGCAACCTCAGG - Intergenic
1021480351 7:21108401-21108423 TCCAGCCAGGAAGCGGCTGCTGG - Intergenic
1021943839 7:25705601-25705623 GCCATCTTGGAAGCGGAGACAGG + Intergenic
1022493890 7:30841072-30841094 TCCACCTGGGAAGGGGCTGCAGG + Intronic
1023688305 7:42759989-42760011 TTCATCTTGGAAGCAGCAGCTGG + Intergenic
1029016020 7:97316254-97316276 ACCATCTTGGAAGTGGCTGGTGG + Intergenic
1030727209 7:112939787-112939809 TCCATCTGGGGAGCGTCTGCGGG - Exonic
1031639165 7:124140608-124140630 TGCATCTTGGAAGCCACAGCAGG - Intergenic
1038685941 8:29718678-29718700 CCCATCTTGGGAGATGCCGCTGG - Intergenic
1043372691 8:79612194-79612216 TCTCTCTTGGAAGCCGCGGCGGG - Intronic
1044756690 8:95470058-95470080 TCCATGTTGGAAGCCTCCACTGG - Intergenic
1046226532 8:111287137-111287159 TCCATTTTGGAAACAGACGCTGG + Intergenic
1053038043 9:34842614-34842636 TCCATCTTGGAAGCAGAGACTGG + Intergenic
1062030032 9:134358092-134358114 GCCCTCTTGGAAGCGGCCCACGG - Intronic
1062398881 9:136363759-136363781 GCCATCTTGGAAGTGGGCGCCGG + Exonic
1193084118 X:77433422-77433444 ACCATTTTGGAAGCAGACGCTGG - Intergenic
1194200860 X:90951605-90951627 ACCATCTTGGAAGTGGCCCGTGG - Intergenic
1196593949 X:117521626-117521648 ACCATCTTGGAAGCAGACACCGG + Intergenic
1200546710 Y:4527063-4527085 ACCATCTTGGAAGTGGCCCGTGG - Intergenic