ID: 1178831469

View in Genome Browser
Species Human (GRCh38)
Location 21:36060370-36060392
Sequence AGATGGAGGCTGCAGTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3590
Summary {0: 1, 1: 9, 2: 154, 3: 1045, 4: 2381}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178831452_1178831469 27 Left 1178831452 21:36060320-36060342 CCCGACCCGGAAGTCCTACTAGC 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831462_1178831469 -7 Left 1178831462 21:36060354-36060376 CCGGCGGCCGCTTCCAAGATGGA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831457_1178831469 13 Left 1178831457 21:36060334-36060356 CCTACTAGCTCACCTAGGCGCCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831455_1178831469 21 Left 1178831455 21:36060326-36060348 CCGGAAGTCCTACTAGCTCACCT 0: 1
1: 0
2: 0
3: 2
4: 123
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831454_1178831469 22 Left 1178831454 21:36060325-36060347 CCCGGAAGTCCTACTAGCTCACC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831460_1178831469 1 Left 1178831460 21:36060346-36060368 CCTAGGCGCCGGCGGCCGCTTCC 0: 1
1: 0
2: 6
3: 15
4: 198
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381
1178831453_1178831469 26 Left 1178831453 21:36060321-36060343 CCGACCCGGAAGTCCTACTAGCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG 0: 1
1: 9
2: 154
3: 1045
4: 2381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178831469 Original CRISPR AGATGGAGGCTGCAGTGGGC GGG Intronic
Too many off-targets to display for this crispr