ID: 1178832169

View in Genome Browser
Species Human (GRCh38)
Location 21:36065076-36065098
Sequence CAGCTTAAACATTCTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178832169_1178832172 26 Left 1178832169 21:36065076-36065098 CCTTCCTGAGAATGTTTAAGCTG 0: 1
1: 0
2: 1
3: 19
4: 143
Right 1178832172 21:36065125-36065147 AATAACCAACTTCTGACAATAGG 0: 1
1: 0
2: 1
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178832169 Original CRISPR CAGCTTAAACATTCTCAGGA AGG (reversed) Intronic
901814719 1:11787627-11787649 CAGCTGAAACATTCCGAAGAGGG - Exonic
912299713 1:108502389-108502411 CTGCTTACACATTTTCAGGAAGG - Intergenic
913419259 1:118646894-118646916 CATCTTAAATATTCACAGAATGG - Intergenic
914903918 1:151728548-151728570 CAGCTCCAACATTCCCAGGAAGG - Intronic
916976634 1:170087406-170087428 CAGCATAAACATTTTTAGCAAGG + Intergenic
918279287 1:182987576-182987598 CTGCTTAAATATTTTCAGGAAGG + Intergenic
919799870 1:201347464-201347486 AAGCTTAAACAATCTCAGTGTGG - Intergenic
923265281 1:232307833-232307855 AAGCTAAAACATACTCAGGCTGG + Intergenic
1062826355 10:571583-571605 CAGCTGACACATTCTCAGTCAGG + Intronic
1063552701 10:7048103-7048125 CAGATTAATCCTTCTCAGGATGG - Intergenic
1063636172 10:7785276-7785298 CAGGTTAAACATTTGCAGGGAGG - Intronic
1064267094 10:13833934-13833956 CAGCTTACACATTCCCAAGGAGG - Intronic
1066367792 10:34793478-34793500 CAGAGTAAACTTTCTAAGGATGG - Intronic
1068398750 10:56500431-56500453 CAGTTAAATCATTCTCAGCAAGG - Intergenic
1070097302 10:73350280-73350302 CAGCTTCAGCATTTTCAGCAAGG + Intronic
1070450029 10:76548829-76548851 CAGATTAAACATTATCTGGCAGG - Intronic
1073316040 10:102581591-102581613 CAGCTTGAGCCTTCTCAGGAAGG + Intronic
1075326193 10:121533981-121534003 CAGCCAAATCAGTCTCAGGATGG + Intronic
1076708955 10:132320594-132320616 CAGCTTAAGTTTTCTCAGGCAGG + Intronic
1079175315 11:18134902-18134924 CTGCTTGTACATTCTCAGAAAGG + Intronic
1080908159 11:36567776-36567798 CAACCCAAACATTCTCAGGGAGG + Intronic
1082673453 11:56066219-56066241 CAGCTTAAACTGTATCATGAGGG - Intergenic
1082731538 11:56803986-56804008 CTCATTTAACATTCTCAGGATGG + Intergenic
1085688082 11:78643632-78643654 AAGTTTAAACATTCACTGGATGG - Intergenic
1086575564 11:88336085-88336107 CAGCTGAATCATTTTCAGGAAGG - Intronic
1088664982 11:112085646-112085668 CAGATTGTACATTCTCAGGTAGG + Intronic
1089673217 11:120071570-120071592 CTGCTTTATCTTTCTCAGGAAGG + Intergenic
1090999405 11:131896115-131896137 CAGCTTTATCTTTCTCAGGCAGG - Intronic
1091269179 11:134293571-134293593 CAGCTTACATATTATCAGAAGGG + Intronic
1092769781 12:11885979-11886001 CAAACTAAACATTATCAGGAAGG + Exonic
1095540266 12:43301485-43301507 AAGCTTAAACATTCTCAAGTGGG + Intergenic
1097372798 12:58804851-58804873 CAGCTTGAAAATTCCCAGGCAGG + Intronic
1099094889 12:78362343-78362365 CAGCTTTAACATTCATAAGATGG + Intergenic
1099305756 12:80953664-80953686 CAGATGAGATATTCTCAGGAGGG + Intronic
1101531081 12:105574278-105574300 CAGGTTAAACATTCAGAGGTGGG + Intergenic
1102714482 12:114958201-114958223 AAGCATAAAAATTCTCTGGAAGG - Intergenic
1104162443 12:126192788-126192810 AAGCTTTAAGAGTCTCAGGAAGG - Intergenic
1104321645 12:127757045-127757067 TATCTGCAACATTCTCAGGAAGG + Intergenic
1105390453 13:19972570-19972592 CAGCTTAGACATTCTTTTGATGG + Intronic
1105957888 13:25301260-25301282 GAGCTTAGAGATGCTCAGGAGGG + Intergenic
1114146806 14:19986552-19986574 CAGATTAAAAATTCTAAGTATGG + Intergenic
1115449819 14:33534362-33534384 CAGTTTTATCATTTTCAGGATGG - Intronic
1116911359 14:50468984-50469006 GAGCATAAACATTCAGAGGAGGG - Intronic
1119975947 14:79023875-79023897 CAGCCAAACCATTATCAGGAGGG + Intronic
1123698202 15:22894634-22894656 CATTTTAAACATTCTAAGCAGGG - Intronic
1124823625 15:33071862-33071884 AAGCTTTAACATTTTCAGGGAGG + Intronic
1125186276 15:36934337-36934359 AAGCTTTAACATTCAAAGGAGGG + Intronic
1125297685 15:38220844-38220866 CAGCTGAAACATTCTGTGGAAGG + Intergenic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1125817585 15:42600002-42600024 CAGCTTAAAGACTCTAAGGCAGG + Intronic
1126545511 15:49869354-49869376 TAGCTTAAACATTCTTATCAAGG + Intronic
1127649085 15:60988716-60988738 CACCTGAAACATTCTCAATAAGG + Intronic
1127818775 15:62637072-62637094 CAGCCTATACAATCTCAGGAAGG - Intronic
1128339250 15:66808869-66808891 CAGCTTCAGCCTTCTCTGGATGG + Intergenic
1130028767 15:80293426-80293448 AAGGTTAAACAGTCTCAGGTGGG - Intergenic
1130202894 15:81849951-81849973 CAGTTTATTCATTCACAGGATGG + Intergenic
1130956753 15:88632293-88632315 CAGCTTGAGAATTCACAGGAAGG - Intergenic
1131005551 15:88974611-88974633 GAGGTTAAACATTCTTATGAGGG - Intergenic
1131292750 15:91121317-91121339 TGGCTTAAGTATTCTCAGGAGGG - Intronic
1132031146 15:98439245-98439267 AAGTTTAAAGATGCTCAGGAAGG - Exonic
1202975924 15_KI270727v1_random:293360-293382 AAGGTTGAACTTTCTCAGGAAGG + Intergenic
1136119221 16:28119429-28119451 CAGTTTAAACATTTTTAGCAAGG - Intronic
1139599006 16:67975521-67975543 CAGCTTTGACTGTCTCAGGAAGG - Intergenic
1146561254 17:33872195-33872217 CAGCTCCAAGATTCTCAGGCTGG - Intronic
1149638008 17:58185676-58185698 CAGCTGAAAGATGCCCAGGAAGG + Intergenic
1151194490 17:72421880-72421902 CAGCTTCAACCCTCTCGGGAAGG + Intergenic
1151287199 17:73121416-73121438 CAGTTTAAACCTTCTCAACAAGG + Intergenic
1155404221 18:25469919-25469941 GAGATTAAACATTGTCTGGAAGG + Intergenic
1155524366 18:26701665-26701687 CTGCTTAAAATCTCTCAGGATGG + Intergenic
1159248601 18:65843299-65843321 CAGATTGAACAACCTCAGGATGG + Intronic
1163223132 19:15935735-15935757 CAGATGAAAGATTCTGAGGAGGG + Intergenic
925988260 2:9233300-9233322 CAGAATAAACATCCTCAGAATGG + Intronic
926177502 2:10608643-10608665 TAGCTTAAACTTTCTGAAGAAGG + Intronic
928219137 2:29388430-29388452 CAGCTAAAACCATCTCAGAAAGG - Intronic
928836426 2:35552310-35552332 CAGCTTTTACATTTTCAGAAGGG + Intergenic
929021041 2:37553293-37553315 CAGCTTAAGAATTGTCGGGAAGG - Intergenic
929303265 2:40330322-40330344 CAGCTTAAAGAATGGCAGGAAGG - Intronic
934050029 2:88202114-88202136 CAGCTTCAGCTTCCTCAGGAAGG - Intergenic
935701622 2:105817213-105817235 CAGATGAAGGATTCTCAGGAAGG + Intronic
936822939 2:116545132-116545154 CAGCTTGATCTTCCTCAGGATGG - Intergenic
937801263 2:126082918-126082940 TAGCTTAAACAATTTCAAGAGGG + Intergenic
938592954 2:132757112-132757134 CAGCTGAAAGCTTTTCAGGAAGG - Intronic
939048588 2:137279981-137280003 GAGGTTACACATTCTCATGAAGG + Intronic
941852868 2:170201598-170201620 CATCTTATATATTCTGAGGAAGG - Intronic
942379347 2:175372068-175372090 CAGCTTAAATCTTCTCATCAGGG - Intergenic
945481280 2:210348715-210348737 CAGCTAAAACAATCTTAAGAGGG - Intergenic
945815015 2:214594036-214594058 CAGCATGAACTTTCTCAGGCAGG + Intergenic
946964031 2:225017739-225017761 CAGCTTAAACATATTCAGCAAGG - Intronic
948118838 2:235513919-235513941 GAGCTCAATCATTCTCGGGAGGG - Intronic
1169294292 20:4379634-4379656 CAAATTATAAATTCTCAGGATGG + Intergenic
1171016887 20:21549951-21549973 CTGCTTAATCATTGTCAGGAGGG + Intergenic
1172305177 20:33875508-33875530 CAGTTTAAAAATTCCCAGCAAGG - Intergenic
1175212084 20:57366010-57366032 GTGCTGAAACATTTTCAGGAAGG + Intronic
1177925624 21:27211115-27211137 CAGCTCAAACATTGGCAGGTGGG + Intergenic
1178273674 21:31216905-31216927 CAGCTTAAAAAGTCTCTGCATGG + Intronic
1178832169 21:36065076-36065098 CAGCTTAAACATTCTCAGGAAGG - Intronic
1179410845 21:41162009-41162031 CAGCATAAACATTTTCAGGAAGG - Intergenic
952754218 3:36851957-36851979 CAGCATAAACATGGTCAGGCAGG + Intronic
953141575 3:40234175-40234197 TAGCAAATACATTCTCAGGAAGG + Intronic
955039118 3:55297879-55297901 CATATTAAGCACTCTCAGGAAGG - Intergenic
956374633 3:68601214-68601236 CAGCTCAAACATAGTCAGAAAGG + Intergenic
958945185 3:100354313-100354335 CAGCTTCACCACTCTCAGGGAGG + Intronic
960739455 3:120817016-120817038 CAGCGTGAACATTCTCAAGCTGG + Intergenic
961684389 3:128619222-128619244 CAGCTTAAATATTGGCAGGTGGG - Intergenic
962070296 3:132026729-132026751 CACTTTAAATCTTCTCAGGATGG + Intronic
963217709 3:142769046-142769068 CAGCTTTAGCATTCTCAGTATGG + Intronic
963671881 3:148261206-148261228 CAGCTGAAAAATTCTGAGCAGGG + Intergenic
968314480 3:197711531-197711553 AAGCATAAAAATTCTCTGGAAGG + Intronic
969397799 4:6934047-6934069 CATCTTAGACATTTGCAGGAAGG + Intronic
970301615 4:14686831-14686853 CACCTAAAACATTCTGAGAAAGG - Intergenic
970813935 4:20131069-20131091 CAGCTTAAACCTCTACAGGAAGG + Intergenic
971725496 4:30306780-30306802 CAACTTATACATTTTCAGAAGGG + Intergenic
976527578 4:86112365-86112387 CAGCTAAAGCAGTGTCAGGAGGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977758516 4:100702222-100702244 ATACTTTAACATTCTCAGGAAGG - Intronic
978586197 4:110278343-110278365 CAGCTGAAACCTTCTCCAGAAGG + Intergenic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
981187302 4:141818671-141818693 CAGCTAAAACAGTGTCAGGACGG + Intergenic
984001356 4:174250366-174250388 CAGCTTATACATTTTATGGAAGG - Intronic
987030968 5:13976487-13976509 CATCTTAAACCATCTCAGGAAGG + Intergenic
987298036 5:16571361-16571383 GGGCTTAATTATTCTCAGGAGGG + Intronic
988817636 5:34850416-34850438 TAGCTCACACATTATCAGGAAGG + Intronic
989984481 5:50681685-50681707 CAGCTTAAAGAATTTCAGGTTGG - Intronic
991277199 5:64863256-64863278 CAGATTAAACATTCTTGGGATGG + Intronic
994163422 5:96582566-96582588 CAGCATAAATGTACTCAGGAAGG + Intronic
996744664 5:126836361-126836383 CAGCTTAAAAATTCACATAAAGG - Exonic
997934036 5:138095359-138095381 CTGCTTTATCATTCTAAGGAAGG - Intergenic
998860657 5:146440368-146440390 CAGCACAAGCAATCTCAGGATGG - Intergenic
998908440 5:146932057-146932079 CAGTTCAAACATACTAAGGAAGG - Intronic
999811320 5:155130269-155130291 CAGCTTAAACTTTCTCCATATGG - Intergenic
1000815294 5:165913929-165913951 TAGCCTAAAGATTCTCAGAAAGG - Intergenic
1004703145 6:18097988-18098010 CAGCTTGAACACTCTCCGAAGGG - Intergenic
1006981607 6:38152316-38152338 CAGCTTCACCATTTTCATGATGG - Exonic
1009777549 6:68224174-68224196 CAGCTTTAAAATACTCAGTATGG + Intergenic
1011401656 6:86969383-86969405 CAGCTTGAACTTTATCAGGAGGG - Intronic
1012589535 6:100963132-100963154 CTGCTAAAACTTTCTCAAGATGG + Intergenic
1013071040 6:106729672-106729694 CAGCTTAAACAATTTGAGGTCGG - Intergenic
1013760568 6:113512810-113512832 CAGTTTAAATATGCTCAGAAGGG - Intergenic
1014584879 6:123185447-123185469 CAGCTAAAACAGTGTTAGGAGGG + Intergenic
1018474260 6:164124433-164124455 CATTTGATACATTCTCAGGAGGG + Intergenic
1024061571 7:45702676-45702698 CAGCTTAATCAGTCTCTGCAGGG + Intronic
1029513809 7:101013367-101013389 CAGCATGAACTTTCTCAGGAAGG - Intronic
1030175476 7:106649300-106649322 CAGCTCAGACATTCTTAAGAAGG + Intergenic
1031786921 7:126045161-126045183 CAGTTTAAGCCTTATCAGGAAGG + Intergenic
1034866112 7:154643808-154643830 CATCATAAACAGTCTCAAGAAGG + Intronic
1035225356 7:157429582-157429604 CAGCTTGGACCTTCCCAGGATGG + Intergenic
1035225680 7:157430895-157430917 CAGCTTGGACCTTCCCAGGATGG + Intergenic
1036436112 8:8735109-8735131 CAGGTTACACATTCTCATGAAGG - Intergenic
1039506156 8:38053985-38054007 CATCTTAAACATTTTCGGTAGGG - Intronic
1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG + Intronic
1042655645 8:71092328-71092350 CTTCTAAAACAATCTCAGGAAGG + Intergenic
1044418046 8:91958330-91958352 CAGGTTAAACATGTTCAGCAAGG - Intronic
1044460208 8:92435276-92435298 CATCTTACACATTTTCAAGAAGG + Intergenic
1045020213 8:98036601-98036623 CAACTTAAACATCATCAGAAGGG + Exonic
1046051543 8:109028891-109028913 CAGCTTTAACATTGACAGTATGG + Intergenic
1047162221 8:122393146-122393168 CAGTTTCAACCTTCCCAGGAAGG + Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1052032375 9:23643443-23643465 CAGTTTAACCATTCTCCGGAGGG - Intergenic
1053002799 9:34586503-34586525 CATCTCAATCATTCTTAGGATGG - Intronic
1053507435 9:38655237-38655259 CAGCTTTTACATTCTCACAAAGG - Intergenic
1058907937 9:109496981-109497003 CTGCTTAAACATTTGCAAGATGG + Intronic
1058952001 9:109912759-109912781 GAGGTTAAATATTCTTAGGATGG + Intronic
1060846163 9:126839282-126839304 TAGCTTAACCATTCTCTGTATGG + Intergenic
1194973469 X:100369466-100369488 CAGCTTTCACATACTCAGCAAGG - Intronic