ID: 1178845527

View in Genome Browser
Species Human (GRCh38)
Location 21:36171208-36171230
Sequence GTATCTGTATAGCTTACGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178845525_1178845527 -5 Left 1178845525 21:36171190-36171212 CCAGCCTTCTTCATGTCAGTATC 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39
1178845523_1178845527 16 Left 1178845523 21:36171169-36171191 CCATGCTCATGAGCAGAGCCTCC 0: 1
1: 0
2: 2
3: 25
4: 252
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39
1178845520_1178845527 30 Left 1178845520 21:36171155-36171177 CCTGGTTCCAAGGCCCATGCTCA 0: 1
1: 0
2: 0
3: 30
4: 271
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39
1178845521_1178845527 23 Left 1178845521 21:36171162-36171184 CCAAGGCCCATGCTCATGAGCAG 0: 1
1: 0
2: 1
3: 19
4: 222
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39
1178845526_1178845527 -9 Left 1178845526 21:36171194-36171216 CCTTCTTCATGTCAGTATCTGTA 0: 1
1: 0
2: 1
3: 18
4: 259
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39
1178845522_1178845527 17 Left 1178845522 21:36171168-36171190 CCCATGCTCATGAGCAGAGCCTC 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39
1178845524_1178845527 -2 Left 1178845524 21:36171187-36171209 CCTCCAGCCTTCTTCATGTCAGT 0: 1
1: 0
2: 1
3: 33
4: 290
Right 1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178845527 Original CRISPR GTATCTGTATAGCTTACGTA AGG Intronic
900784990 1:4643768-4643790 GTATCTGTCTAGATTATGAACGG + Intergenic
907724799 1:57009499-57009521 GTAACTGTCTAACTTACGTGTGG + Intronic
916203301 1:162292123-162292145 GGATCTGCATAGGTTACATAAGG + Intronic
919140806 1:193569054-193569076 GTATCTGTTTAGCTTATAAATGG + Intergenic
1066363579 10:34754756-34754778 GTATGTGTATAGTTTAAGTCAGG - Intronic
1086260073 11:84929101-84929123 GTATCTTTAGGGCTTATGTAAGG - Intronic
1087438537 11:98153313-98153335 GTAACTGTATAGGTTTCATAAGG + Intergenic
1090228626 11:125086192-125086214 GTATCTCTATAGCTCTAGTATGG + Exonic
1093414930 12:18908898-18908920 GTATCTTTATAACTTAGGTTAGG - Intergenic
1098599574 12:72315039-72315061 ATATCTGTATAACTTACATTAGG + Intronic
1099648166 12:85387720-85387742 ACATCTGTATAGCTGATGTAAGG + Intergenic
1112536630 13:100263808-100263830 GTATCTGTATATCATATATATGG + Intronic
1116091712 14:40316117-40316139 GTCTCTGTATAACTTACTGAAGG - Intergenic
1126296885 15:47149221-47149243 CTATCTGTATATCTTTGGTAAGG - Intergenic
1146248952 17:31320290-31320312 GAATTTCTATAGCATACGTAGGG - Intronic
1153471305 18:5449188-5449210 CTATCTGTATATCTTTGGTAAGG - Intronic
1155435214 18:25805595-25805617 GTATGTGTTTACTTTACGTAAGG + Intergenic
1160083100 18:75749041-75749063 GTATGTTTACAGCTAACGTAAGG - Intergenic
1163521164 19:17792914-17792936 GTATCTGTATGTCTTACACATGG + Intergenic
947883989 2:233548498-233548520 GTAACTGTATAGCTAAGGAATGG + Intronic
1169015251 20:2287357-2287379 GTATCTGCATAGATTATGTGTGG + Intergenic
1177603542 21:23347905-23347927 GTGTGTGTATAGCTTAAGCATGG - Intergenic
1178845527 21:36171208-36171230 GTATCTGTATAGCTTACGTAAGG + Intronic
951257376 3:20465805-20465827 GTATCTGTATATCTTTGGTGAGG + Intergenic
951465339 3:22994898-22994920 TTACCTGTATAACTTATGTAAGG + Intergenic
952486319 3:33815101-33815123 GTATCTATATATCTTATATAAGG + Intronic
963757374 3:149249632-149249654 ATATCTATATAACTTACTTATGG - Intergenic
975678988 4:76856613-76856635 GGATCTGTATAGATTACAAAAGG - Intergenic
982574529 4:157092771-157092793 GTGTTTGTATAGCTTTCTTAAGG + Intronic
984944273 4:184959032-184959054 GTTTCTGTGTAGCTTACATCAGG - Intergenic
985986681 5:3522042-3522064 GTTTCTGTATAGCCTACATGGGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
1008464756 6:51817895-51817917 GTGTCTGTATAGCCCACGCACGG - Intronic
1016913948 6:149227403-149227425 GTATCTGAATAGCCTATGTCTGG - Intronic
1035959028 8:4116483-4116505 GGATGTGTACAGCTTACGTTAGG - Intronic
1035959037 8:4116561-4116583 GGATGTGTACAGCTTACGTTAGG - Intronic
1035959045 8:4116639-4116661 GGATGTGTACAGCTTACGTTAGG - Intronic
1050580150 9:7045784-7045806 GTATCTGTATAACTTTTGTTAGG - Intronic
1054684756 9:68262157-68262179 ATATTTGTATAGCTTTCCTATGG + Intronic
1198961173 X:142185289-142185311 GTCTTTGTATAGATTATGTAAGG + Intergenic