ID: 1178847112

View in Genome Browser
Species Human (GRCh38)
Location 21:36183062-36183084
Sequence ACAGCTCCTGCACTCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1215
Summary {0: 1, 1: 1, 2: 5, 3: 104, 4: 1104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178847112 Original CRISPR ACAGCTCCTGCACTCTGGCC TGG (reversed) Intronic
900340526 1:2186606-2186628 TCGGCTCCTGGACTCTGCCCTGG - Intronic
900548116 1:3239902-3239924 AGAGCCACTGCACTCTAGCCTGG + Intronic
900998564 1:6135964-6135986 CAAGCCACTGCACTCTGGCCTGG + Intronic
901046191 1:6397216-6397238 ACAGCCACTGCACTCCAGCCTGG + Intergenic
901126519 1:6933112-6933134 ACAGCTACTGCACTCCAGCCTGG - Intronic
901592425 1:10356562-10356584 ATAGCTACTACACTCTAGCCTGG - Intronic
901878937 1:12182703-12182725 ACAGTGCCTGCCATCTGGCCTGG + Intronic
902265707 1:15261963-15261985 ATAGCTACTGCACTCCAGCCTGG + Intronic
902569370 1:17337195-17337217 ACCGCCCCTGCACTCCAGCCTGG - Intronic
902904786 1:19548201-19548223 ACTGCCCCTGCACTCCAGCCTGG - Intergenic
903095040 1:20963882-20963904 ACCGCACTTGCACTCTAGCCTGG + Intronic
903151014 1:21408763-21408785 ACTGCACCTGCACTCTAACCTGG + Intergenic
903177592 1:21590164-21590186 ACGGTTCCTGCCCTGTGGCCAGG + Intergenic
903180103 1:21601062-21601084 ATAGCCACTGCACTCTAGCCTGG - Intronic
903259599 1:22124201-22124223 GCAGATCCTGCTCCCTGGCCAGG + Intronic
903407883 1:23113834-23113856 TCAGCTACTGCACTCCAGCCTGG + Intronic
903432364 1:23316270-23316292 GCAGCTACTGCACTCCAGCCTGG + Intronic
903492046 1:23736632-23736654 ACAGCCACTGCACTCCAGCCTGG - Intergenic
903549345 1:24146955-24146977 TGAGCCACTGCACTCTGGCCTGG + Intergenic
903570840 1:24303757-24303779 ACAGCCACTGCACTCCAGCCTGG - Intergenic
903649281 1:24913252-24913274 ACAGCTCCTCCAGCATGGCCTGG + Intronic
903835815 1:26202655-26202677 ACAGCCCCTGGCCTCTGCCCAGG - Exonic
904055320 1:27666244-27666266 ATAGCCACTGCACTCTAGCCTGG + Exonic
904176462 1:28633208-28633230 TGGGCTCCTGTACTCTGGCCTGG - Intronic
904182105 1:28673292-28673314 ACAGCCACTGCACTCCAGCCTGG - Intronic
904369518 1:30039759-30039781 CCAGCTCCTGGATCCTGGCCTGG - Intergenic
904467899 1:30718906-30718928 ACACGTCCTGCACGCTGTCCTGG + Exonic
904689735 1:32284949-32284971 ACAGCTGCTGCACTCCAGCCTGG + Intronic
904999562 1:34657661-34657683 TCAGCCTCTGCACTCTGGGCAGG - Intergenic
905032487 1:34896543-34896565 CTAGCCACTGCACTCTGGCCTGG + Intronic
905153045 1:35948021-35948043 ACAGCCACTGCACTCCAGCCGGG + Intronic
905280245 1:36844439-36844461 AATGCTCCTGCACCCTGGCATGG + Intronic
905345866 1:37310876-37310898 AACGCCACTGCACTCTGGCCTGG - Intergenic
905391462 1:37638503-37638525 AAAGTTCCTGCTCTTTGGCCTGG - Intergenic
905587004 1:39128252-39128274 ACAGCCACTGCACACTAGCCTGG - Intronic
905823307 1:41011009-41011031 ACCGCTCCTGCCCTAAGGCCTGG + Intronic
906012247 1:42538560-42538582 ATAGCTACTGCACTCTAGCCTGG + Intronic
906091900 1:43186565-43186587 AGTGCCACTGCACTCTGGCCTGG + Intronic
906123842 1:43414232-43414254 ATCGCACCTGCACTCTAGCCTGG + Intronic
906309289 1:44741639-44741661 CGAGCCACTGCACTCTGGCCTGG + Intronic
906370518 1:45249195-45249217 ATAGCCACTGCACTCTAGCCTGG - Intronic
906796660 1:48701503-48701525 ACAGCCACTGCACTCCAGCCTGG - Intronic
906983752 1:50660538-50660560 GAACCTACTGCACTCTGGCCTGG - Intronic
907198762 1:52708177-52708199 ATAGCCACTGCACTCTAGCCTGG - Intergenic
907206865 1:52780659-52780681 ACAGCCACTGCACTCTTGCCTGG - Intronic
907335172 1:53694900-53694922 ACAGCCACTGCACTCCAGCCTGG + Intronic
907342319 1:53744650-53744672 ATAGCCACTGCACTCTAGCCTGG + Intergenic
907350623 1:53827307-53827329 ATAGCTCCTGCACTCCAGCCTGG - Intronic
908161940 1:61418414-61418436 AAAGCCACTGCACTCTAGCCTGG + Intronic
908270424 1:62416683-62416705 AGCGCTCCTGCACTCCAGCCTGG - Intergenic
909156417 1:72083389-72083411 ACAGCCACTGCATTCCGGCCTGG - Intronic
910308605 1:85797162-85797184 GCAACTACTGCACTCCGGCCTGG + Intronic
910365698 1:86462744-86462766 ACACCACCTGCACTCTAGCATGG - Intergenic
911710051 1:101061426-101061448 TGAGCTACTGCACTCTGGTCTGG - Intergenic
912162427 1:107001763-107001785 AGGGCTCCTGCACTCAGGCTGGG - Intergenic
912183232 1:107243598-107243620 ACAGCTGGTGCGCTCTAGCCAGG - Intronic
912337147 1:108873947-108873969 CCAGCCACTGCACTCTAGCCTGG - Intronic
912434614 1:109652379-109652401 AGAGCTACTGCACTCCAGCCTGG + Intergenic
912773111 1:112483148-112483170 ATAGCCACTGCACTCTAGCCTGG + Intronic
912944865 1:114076473-114076495 GTAGCACCTGCACTTTGGCCAGG + Intergenic
912965880 1:114237266-114237288 ATAGCTACTGCACTCCAGCCTGG - Intergenic
913367490 1:118057016-118057038 AGCGCCACTGCACTCTGGCCTGG - Intronic
915039974 1:152960436-152960458 AGAGCTCCTGCTCTCTTCCCAGG + Intergenic
915101035 1:153500487-153500509 ATAGCTACTGCACTCTAGCCTGG - Intergenic
915158228 1:153896114-153896136 ACAGCCACTGCACTCCAGCCTGG + Intronic
915191636 1:154155532-154155554 GCATTTCCTGCATTCTGGCCTGG - Intronic
915316320 1:155030942-155030964 CCAGCTCCTGCTCTCAGGGCAGG + Intronic
915417571 1:155753737-155753759 ACAGCCACTGCACTCCAGCCTGG - Intronic
915431739 1:155872025-155872047 AAAGCTACTGCACTCTAGCCTGG + Intronic
915724628 1:158008561-158008583 ACAGGACCTGGACCCTGGCCTGG + Intronic
915770803 1:158420788-158420810 GCAGCTGCTGCAGCCTGGCCAGG + Exonic
915774259 1:158465618-158465640 GCAGCTGCTGCAGCCTGGCCAGG - Exonic
917059678 1:171023174-171023196 CCTGCCCCTGCACTCTAGCCTGG + Intronic
917104260 1:171476550-171476572 TCAGCCTCTGCACTCTAGCCTGG + Intergenic
917878104 1:179305288-179305310 ATAGCCCCTGCACTCCAGCCTGG - Intronic
918325878 1:183410277-183410299 AGAGCCACTGCACTCTAGCCTGG + Intronic
918348232 1:183625669-183625691 ACAGCCACTGCACTCCAGCCTGG + Intronic
918454053 1:184688775-184688797 ACAGCCACTGCACTCCAGCCTGG + Intergenic
919035951 1:192309105-192309127 AGTGCCACTGCACTCTGGCCTGG + Intergenic
919308610 1:195877253-195877275 ACAGCCACTGCACTCCAGCCTGG + Intergenic
919362954 1:196617667-196617689 AGCGCTCCTGCACTCCAGCCTGG + Intergenic
919438040 1:197588072-197588094 TCACCTCCTGCCATCTGGCCTGG + Intronic
919673563 1:200359821-200359843 ACAGCCACTGCACTCCAGCCTGG + Intergenic
919712356 1:200739919-200739941 AAATCGCCTGCAATCTGGCCTGG + Exonic
919758196 1:201079075-201079097 CAAGCCACTGCACTCTGGCCTGG + Intronic
919942432 1:202297556-202297578 ACAGTTCCTGCAGTCTGCCCAGG - Exonic
920273336 1:204784122-204784144 AGAGCCACTGCATTCTGGCCTGG - Intergenic
920277987 1:204822684-204822706 ATAGCTACTGCACTCCAGCCTGG - Intergenic
921110258 1:212029517-212029539 TCAGATCCTGCACTCTTGCAAGG + Intronic
921246411 1:213246844-213246866 ATAGCTACTGCACTCCAGCCTGG + Intronic
922013288 1:221614847-221614869 AGTGCTCCTGCACTCCAGCCTGG - Intergenic
922062193 1:222103653-222103675 AAAGGTCCAGCACACTGGCCTGG + Intergenic
922304095 1:224329176-224329198 ACAGCCACTGCACTCTAGCCTGG + Intronic
922496379 1:226061801-226061823 GCAGCTCCTGCACCAGGGCCTGG - Intergenic
922724302 1:227915323-227915345 ACAGCCCCTGCATTGGGGCCTGG - Intergenic
923893264 1:238239106-238239128 AGCGCCACTGCACTCTGGCCTGG - Intergenic
924115064 1:240736877-240736899 TTAGCTACTGCACTCTAGCCTGG + Intergenic
924273760 1:242363406-242363428 ACAGCCACTGCACTCCAGCCTGG + Intronic
924408470 1:243777339-243777361 ACACCTCCTGCCGTGTGGCCTGG + Intronic
924700236 1:246444168-246444190 CAAGCACCTGCACTCTAGCCTGG - Intronic
1062775390 10:141454-141476 TCAGCTACTGCACTCCGACCTGG + Intronic
1062787078 10:273640-273662 ACGCCACCTGCACTCTAGCCTGG - Intergenic
1063131256 10:3179674-3179696 CAAGCCACTGCACTCTGGCCTGG - Intergenic
1063483212 10:6395104-6395126 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1064166442 10:12990214-12990236 GCCACTACTGCACTCTGGCCTGG + Intronic
1064173453 10:13054099-13054121 AGGGCCGCTGCACTCTGGCCTGG + Intronic
1064228904 10:13512223-13512245 ACAGCCTCTGCACTCCAGCCTGG + Intronic
1064253408 10:13724342-13724364 AGTGCCACTGCACTCTGGCCTGG + Intronic
1064304767 10:14155249-14155271 GGTGCTACTGCACTCTGGCCTGG + Intronic
1064629283 10:17293242-17293264 ACCGCCCCTGCACTCCAGCCTGG - Intergenic
1064991246 10:21258834-21258856 ACGGCCACTGCACTCTGGCCTGG + Intergenic
1065168795 10:23007654-23007676 ACTGCCACTGCACTCTAGCCTGG + Intronic
1065843627 10:29726701-29726723 CACGCTGCTGCACTCTGGCCTGG + Intronic
1065939960 10:30555625-30555647 ATAGCCACTGCACTCTGGCCTGG - Intergenic
1066312800 10:34213931-34213953 ACTGCAACTGCACTCTAGCCTGG - Intronic
1066710948 10:38233248-38233270 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1067272719 10:44805901-44805923 ACAGAACCTGCGCTCTGGCAGGG - Intergenic
1068267476 10:54671887-54671909 TCACCTCCTGCTCTGTGGCCTGG - Intronic
1069049201 10:63774934-63774956 ACCGCCACTGCACTCTAGCCTGG - Intergenic
1069481374 10:68785262-68785284 CATGCTACTGCACTCTGGCCTGG - Intronic
1069995421 10:72339193-72339215 GAGGCTCCTGCACTCTAGCCAGG + Intronic
1070208211 10:74286094-74286116 CATGCTCCTGCACTCTAGCCTGG - Intronic
1070805391 10:79267804-79267826 ACCTCTCCTGCTCACTGGCCTGG - Intronic
1070890344 10:79938268-79938290 ACAGCCCCTGAGCTTTGGCCAGG - Intronic
1071136203 10:82457475-82457497 TCACCTCCTGCTCTGTGGCCTGG + Intronic
1071589582 10:86860104-86860126 ATAGCTCCTGCACTCCAGCCTGG + Intronic
1071596445 10:86930771-86930793 ACAGCCACTGCACACTAGCCTGG - Exonic
1071604725 10:86977513-86977535 ACAGCCACTGCACTCCTGCCTGG - Intronic
1071855112 10:89616584-89616606 ATAGTTGCTGCACTCTGGCCTGG + Intronic
1072014533 10:91333878-91333900 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1072075087 10:91963149-91963171 TCATCCACTGCACTCTGGCCTGG - Intronic
1072267329 10:93743251-93743273 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1072352699 10:94573507-94573529 ACAGCCACTGCACTCCAGCCTGG - Intronic
1072446321 10:95501685-95501707 ACAGCCACTGCACTCCAGCCTGG + Intronic
1072726415 10:97816762-97816784 ACAGTTGCTGGGCTCTGGCCAGG + Intergenic
1072996884 10:100253050-100253072 ATAGCCACTGCACTCTAGCCTGG - Intronic
1073050908 10:100666719-100666741 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1073063041 10:100743640-100743662 AGATCCCTTGCACTCTGGCCTGG + Intronic
1073258690 10:102172467-102172489 ATAGCCACTGCACTATGGCCTGG - Intergenic
1073365166 10:102934316-102934338 ACAGCACTTGCACTCCAGCCTGG - Intronic
1073834900 10:107429941-107429963 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1074074009 10:110103740-110103762 ACAGCCACTGCACACTAGCCTGG - Intronic
1074076656 10:110132879-110132901 ACTGCCACTGCACTCCGGCCTGG + Intronic
1074518884 10:114198684-114198706 ACAGCCACTGCACTCCAGCCTGG - Intronic
1074724037 10:116289314-116289336 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1075043665 10:119128562-119128584 CATGCTACTGCACTCTGGCCTGG + Intronic
1075888630 10:125925438-125925460 ACAGCCCCTGCACTATAGCCTGG - Intronic
1076678069 10:132158269-132158291 TCAGATCCTGCATTCTGGTCAGG - Intronic
1076987416 11:248928-248950 ACAGCTCATGCACCCTGTGCTGG + Exonic
1077215025 11:1391601-1391623 CCAGGTCCTGCCCTGTGGCCAGG - Intronic
1077319836 11:1936225-1936247 CCAGCATCTGCACTCTGGCCCGG - Intronic
1078983951 11:16571461-16571483 ATAGCCACTGCACTCTAGCCTGG - Intronic
1078998010 11:16723736-16723758 ACAGCCACTGCACTCCAGCCTGG + Intronic
1079044769 11:17091611-17091633 ACAGCTCCTCCTATTTGGCCTGG + Exonic
1079737353 11:24013316-24013338 AGGGCTCCTCCACTGTGGCCTGG - Intergenic
1080179747 11:29411466-29411488 GCACCTCCTGCACTCCAGCCTGG - Intergenic
1080465185 11:32489583-32489605 TCAGCCACTGCACTCTCGCCTGG - Intergenic
1080507139 11:32926047-32926069 CCAGCTGCTGCACTCTAGCTTGG + Intronic
1080514802 11:33010184-33010206 CAAGCCACTGCACTCTGGCCTGG + Intergenic
1080964736 11:37201681-37201703 ACGGCCACTGCACTCTAGCCTGG - Intergenic
1081331274 11:41803478-41803500 AGAGCTGCTGCACTCCAGCCTGG - Intergenic
1081475282 11:43424134-43424156 AGAGCCACTGCACTCTAGCCTGG - Intronic
1082638993 11:55631343-55631365 ACTGCCACTGCACTCTAGCCTGG + Intergenic
1082825978 11:57579202-57579224 ATAGCTGCTGCACTCCAGCCTGG - Intergenic
1082955955 11:58870062-58870084 CCAGCCACTGCACTCTAGCCTGG + Intronic
1082991958 11:59214428-59214450 ATAGCTACTGCACTCAAGCCTGG - Intergenic
1083292058 11:61695926-61695948 ACAGCCCCTGGGCTCTGGCCCGG - Intronic
1083783361 11:64929815-64929837 ATAGCTCCTGGACTGAGGCCGGG + Intronic
1083943722 11:65912426-65912448 CCAGCTACTGCACTCCAGCCTGG - Intergenic
1084015093 11:66373996-66374018 CCTGCCACTGCACTCTGGCCTGG - Intergenic
1084120238 11:67064871-67064893 ATAGCTGCTGCACTCCAGCCTGG + Intronic
1084422262 11:69066300-69066322 TCTGCTCCTCCACTCTGGCTTGG + Intronic
1084513468 11:69621147-69621169 ACAGCTACTGCAGTCCAGCCTGG + Intergenic
1084849159 11:71924638-71924660 ACTGCCACTGCACTCTAGCCTGG + Intronic
1084867722 11:72073261-72073283 ACAGCCACTGCACTCCAGCCTGG + Intronic
1085140027 11:74131627-74131649 CATGCTACTGCACTCTGGCCTGG - Intronic
1085144139 11:74177403-74177425 AATGCCCCTGCACTCTAGCCTGG + Intronic
1085157393 11:74308493-74308515 AGAGCCACTGCACTCTAGCCTGG + Intronic
1085622841 11:78050342-78050364 ACACTTCCTGGACTCTGGCCTGG + Intronic
1085862700 11:80253277-80253299 ACACCACCTGCACTCTGCACTGG + Intergenic
1085995938 11:81914177-81914199 CCTGCCACTGCACTCTGGCCTGG - Intergenic
1086140577 11:83494383-83494405 ACAGCTCCTGCATCCTGGGATGG - Intronic
1086201631 11:84210237-84210259 AGAGCCACTGCACTCTAGCCTGG + Intronic
1086386987 11:86319279-86319301 CTTGCTACTGCACTCTGGCCTGG - Intronic
1086724538 11:90166789-90166811 AGCGCTACTGCACTCTGGCCTGG + Intronic
1086761041 11:90631596-90631618 AAAGCTACTGCACTCCAGCCTGG - Intergenic
1086772747 11:90790078-90790100 AGAGCTACTGCGCTCTAGCCTGG - Intergenic
1087028119 11:93672453-93672475 AGAGCCACTGCACTCTAGCCTGG - Intronic
1087160970 11:94947667-94947689 ATAGCATCTGCACTCTGGCCTGG - Intergenic
1087183658 11:95162625-95162647 AGTGCTGCTGCACTCTGGCCAGG + Intergenic
1087244425 11:95817320-95817342 TCAGCCACTGCACTCTGGCCTGG + Intronic
1087315779 11:96600507-96600529 TGCGCTCCTGCACTCTAGCCTGG + Intergenic
1087843484 11:102944648-102944670 ACTGCCACTGCACTCTAGCCTGG - Intronic
1088250303 11:107856651-107856673 AGAGCCTCTGCACTCAGGCCTGG + Intronic
1088273417 11:108059043-108059065 ACAGCCACTGCACTCCAGCCTGG - Intronic
1088282846 11:108153128-108153150 ACAGCCACTGCACTCTAGCCTGG + Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1089462899 11:118663083-118663105 GCAGCTCCTGCCCCTTGGCCTGG + Exonic
1089546296 11:119228651-119228673 ACAGCCACTGCACTCCAGCCTGG - Intronic
1089834305 11:121356762-121356784 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1090047280 11:123346918-123346940 AGTGCTACTGCACTCTAGCCTGG + Intergenic
1090353863 11:126126007-126126029 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1090370191 11:126245236-126245258 ATAGCCACTGCACTCTAGCCTGG + Intronic
1090394992 11:126413136-126413158 AGAGCTGCTGCACTCCAGCCTGG - Intronic
1090582384 11:128174174-128174196 ACTGCCACTGCACTCTAGCCTGG + Intergenic
1090839325 11:130474940-130474962 ACAGCTACTGCTGTCTGCCCTGG + Exonic
1090984268 11:131751544-131751566 ACTGCCACTGCACTCTGGCCTGG + Intronic
1091397645 12:163478-163500 ACAGCACCTGCACGCGGGCAGGG - Exonic
1091614713 12:2041318-2041340 AGCGCCACTGCACTCTGGCCTGG - Intronic
1091837044 12:3593362-3593384 CCAGCTCCTCCGCTCTGCCCTGG + Exonic
1091958172 12:4665993-4666015 ACAGGTCTTGCTCTCTTGCCCGG + Intronic
1092158348 12:6299868-6299890 ACACCTACTGCACTCCAGCCTGG + Intergenic
1092197017 12:6555747-6555769 CCAGCTCATGCACCTTGGCCAGG + Exonic
1092346858 12:7722557-7722579 ACAGCTGCTGCACTGCAGCCTGG + Intergenic
1093551647 12:20419779-20419801 ACAGCCACTGCACTCCAGCCTGG - Intronic
1093681191 12:22005636-22005658 CATGCTCCTGCACTCTAGCCTGG - Intergenic
1094174124 12:27524280-27524302 AAAGCCCCAGCACTCCGGCCCGG - Exonic
1094562240 12:31566285-31566307 ATAGCTACTGCATTCCGGCCAGG + Intronic
1094801986 12:34048022-34048044 ACATCCCCTGAATTCTGGCCAGG - Intergenic
1095202755 12:39404117-39404139 ATAGCCACTGCACTCTAGCCTGG - Intronic
1095480762 12:42633145-42633167 ACAGCCACTGCACTCTAGCCTGG + Intergenic
1096013557 12:48245072-48245094 AAAGCCACTGCACTCTGGCCTGG - Intergenic
1096177003 12:49528557-49528579 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1096209751 12:49755875-49755897 CAAGCCACTGCACTCTGGCCTGG - Intronic
1096219231 12:49818086-49818108 CGCGCTGCTGCACTCTGGCCTGG + Intronic
1096400119 12:51299029-51299051 AGTGCTACTGCACTCTAGCCTGG + Intronic
1096435586 12:51588841-51588863 ATAGCTGCTGCACTCAAGCCTGG - Intergenic
1096799389 12:54099652-54099674 GCAGCTACTGCAGTGTGGCCTGG - Intergenic
1097268173 12:57757601-57757623 ACAGCCACTGCACTCCAGCCTGG + Intronic
1097283056 12:57857454-57857476 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1097490403 12:60261690-60261712 CCAGCCCCTGCACTCCAGCCTGG - Intergenic
1097711453 12:62921737-62921759 ACAGCTATTGCACTCCAGCCAGG + Intronic
1097869646 12:64590191-64590213 GGAGCCACTGCACTCTGGCCTGG + Intergenic
1097956434 12:65490728-65490750 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1098287547 12:68922958-68922980 ACAGCCACTGCACTCCAGCCTGG - Intronic
1098297901 12:69022761-69022783 CCTGCCACTGCACTCTGGCCGGG + Intergenic
1098513134 12:71342402-71342424 TGAGCCACTGCACTCTGGCCTGG - Intronic
1098553725 12:71794478-71794500 AGCGCCACTGCACTCTGGCCTGG - Exonic
1098557434 12:71835350-71835372 ACAGCTCCTGCATGGTGGCCTGG + Intergenic
1098614469 12:72506265-72506287 AGATCTCCTGCACTCCAGCCTGG + Intronic
1099609362 12:84848148-84848170 ATAGTTACTGCACTCTAGCCTGG + Intergenic
1099681840 12:85838824-85838846 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1100356095 12:93831326-93831348 ACAGCCACTGCACTCTGGCCTGG + Intronic
1100583373 12:95956756-95956778 ACAGCTCCTCCTCTGTGGCTTGG - Exonic
1100859728 12:98791588-98791610 ACAGCCACTGCATTCTAGCCGGG - Intronic
1101115630 12:101528890-101528912 TCACATCCTGCACTCTAGCCTGG - Intergenic
1101150715 12:101879945-101879967 AGAGCTACTGCACTCCAGCCTGG + Intronic
1101598230 12:106186448-106186470 CCAGCCCCAGCACTCTAGCCAGG + Intergenic
1101772539 12:107764672-107764694 ACAGCCACTGCACTCTGGCCTGG + Intergenic
1101941499 12:109102432-109102454 CCTGCTACTGCACTCTAGCCTGG + Intronic
1101948483 12:109156189-109156211 ACAGCCACTGCACTCTAGCCTGG + Intronic
1101979749 12:109395689-109395711 CGTGCTACTGCACTCTGGCCTGG + Intronic
1102048671 12:109846400-109846422 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1102135280 12:110568985-110569007 ATAGCTACTGCACTCCAGCCTGG + Intronic
1102140569 12:110611579-110611601 CCTGCTACTGCACTCTAGCCTGG + Intergenic
1102145682 12:110653413-110653435 AGTGCTCCTGCACTCCAGCCTGG + Intronic
1102368443 12:112360284-112360306 ATAGCCACTGCACTCTAGCCTGG + Intronic
1102403379 12:112650771-112650793 TCTGCTCCTGCACTCCAGCCTGG - Intronic
1102485844 12:113255866-113255888 ATAGCTACTGCACTCCAGCCTGG - Intronic
1102655964 12:114482365-114482387 ACACCAGCTGTACTCTGGCCTGG - Intergenic
1102819170 12:115893505-115893527 ACTGCTGCTGCACTCCAGCCTGG + Intergenic
1102880574 12:116481861-116481883 AGAGCCCCTGCACTCCAGCCTGG + Intergenic
1103454254 12:121052431-121052453 CCAGCCACTGCACTCTAGCCTGG + Intergenic
1103493309 12:121340578-121340600 TGCGCTACTGCACTCTGGCCTGG - Intronic
1103530950 12:121601266-121601288 TCAGCTGCTGCCCTCTTGCCTGG - Intergenic
1103544175 12:121687909-121687931 GCAGCCATTGCACTCTGGCCTGG + Intergenic
1103551089 12:121737964-121737986 GGAGCCCCTGCACTCTAGCCTGG + Intronic
1103621745 12:122191215-122191237 ACAGCTCTGGCAAGCTGGCCTGG - Intronic
1103633704 12:122284981-122285003 AGAGCTGCTGTACTCTAGCCTGG - Intronic
1103667090 12:122577119-122577141 ACAGCCACTGCACTCCAGCCTGG - Intronic
1103676729 12:122661597-122661619 TCAGCTCCTGTCCTCTGGACAGG - Intergenic
1103695848 12:122814862-122814884 ATAGCTACTGCACTCCAGCCTGG - Intronic
1103747516 12:123135739-123135761 ATAGCTACTGCACTCCAGCCTGG - Intronic
1103748759 12:123144473-123144495 CGTGCCCCTGCACTCTGGCCTGG - Intronic
1104252176 12:127105447-127105469 ACAGCTCCTGCACTCCAGCCTGG - Intergenic
1104544712 12:129700333-129700355 ACAGAACCTGCACTTTGGGCCGG + Exonic
1104755628 12:131267637-131267659 TCAGCTCCTCCACTCTGTTCAGG + Intergenic
1104954253 12:132456799-132456821 ACAGCTCCTGCCCTCACCCCAGG + Intergenic
1105461601 13:20595228-20595250 ATAGCCACTGCACTCTAGCCTGG + Intronic
1105558424 13:21467443-21467465 CCTGCCACTGCACTCTGGCCTGG - Intergenic
1105740719 13:23320252-23320274 AGAGCCACTGCACTCTAGCCTGG + Intronic
1105956804 13:25291075-25291097 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1105992547 13:25637047-25637069 ACCACTATTGCACTCTGGCCTGG + Intronic
1107206783 13:37800234-37800256 ATAGCCACTGCACTCTAGCCTGG - Intronic
1107519631 13:41167052-41167074 TGTGCTACTGCACTCTGGCCTGG + Intergenic
1107727787 13:43317308-43317330 TCAGCTGCTGCACCCTGGTCTGG + Intronic
1107946276 13:45419912-45419934 CTAGCTGCTGCACTCTAGCCTGG + Intergenic
1107980734 13:45732106-45732128 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1108075357 13:46673796-46673818 ACAGCCGCTGCACTCCAGCCTGG - Intronic
1108242322 13:48478634-48478656 AAAGGTCCTGAACTTTGGCCTGG - Intronic
1108365353 13:49705928-49705950 ATAGCAACTGCACTCTAGCCTGG + Intronic
1108368062 13:49737639-49737661 ACAGTCACTGCACTCTAGCCTGG - Intronic
1108399108 13:50021332-50021354 CCAACTCCTGCACTCCAGCCTGG - Intergenic
1109187142 13:59283480-59283502 AGAGCCACTGCAGTCTGGCCTGG + Intergenic
1109271958 13:60266064-60266086 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1109919444 13:69036593-69036615 AGAACTCCTGCACTCCAGCCTGG - Intergenic
1110863651 13:80370875-80370897 TCTGCCACTGCACTCTGGCCTGG + Intergenic
1110897369 13:80771654-80771676 AGCGCTACTGCACTCTGGCCTGG + Intergenic
1111201257 13:84940341-84940363 TCACCTCCTGCCCTGTGGCCCGG - Intergenic
1111373792 13:87352459-87352481 GCAGCTACTGCCCTCTGGCAGGG + Intergenic
1111905218 13:94247867-94247889 ACAGCCACTGCACTCTACCCTGG - Intronic
1111987502 13:95079790-95079812 ACGGCCACTGCACTCTAGCCTGG + Intronic
1112574822 13:100626491-100626513 ATAGCTACTGCACTCCAGCCTGG - Intronic
1113469371 13:110533641-110533663 ACTGCCACTGCACTCTAGCCCGG + Intronic
1113549012 13:111177222-111177244 ACAGCTGGTGCATTGTGGCCGGG + Intronic
1113843437 13:113372902-113372924 GCAGGTACTGCACTCTAGCCTGG - Intergenic
1113900577 13:113794546-113794568 ACAGCACCCGCCCTCTGGTCAGG + Intronic
1114251294 14:20963821-20963843 ATAGCCACTGCACTCCGGCCTGG + Intergenic
1114306621 14:21429532-21429554 ATAGCCACTGCACTCTAGCCTGG - Intronic
1114455667 14:22851756-22851778 ATTGATCCTGCTCTCTGGCCTGG - Intergenic
1115214501 14:31001496-31001518 ACTGCTACTGCACTCCAGCCTGG + Intronic
1115257884 14:31421863-31421885 ATAGCCACTGCACTCCGGCCTGG - Intronic
1115634766 14:35280760-35280782 ATAGCTACTGCACTCCAGCCTGG - Intronic
1115638559 14:35315523-35315545 ATAGCCACTGCACTCTAGCCTGG + Intronic
1115691222 14:35845786-35845808 ACAGCCACTGCACTCCAGCCTGG - Intronic
1115720184 14:36152420-36152442 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1116049547 14:39786467-39786489 ATGGCCACTGCACTCTGGCCTGG - Intergenic
1116533090 14:45996702-45996724 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1117151245 14:52890399-52890421 GCAGCCACTGCACTCCGGCCTGG + Intronic
1118403050 14:65396876-65396898 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1118573740 14:67220396-67220418 AGAGCCACTGCACTCTAGCCTGG + Intronic
1118789081 14:69072577-69072599 ATAGCCACTGCACTCTAGCCTGG + Intronic
1119067659 14:71546417-71546439 ACTGCACCTGCACTCCAGCCTGG - Intronic
1119131205 14:72174623-72174645 ACAGTTCATGCACTCTGACTGGG - Intronic
1119245199 14:73098684-73098706 GCAGCTGCTGCACTCCAGCCTGG - Intronic
1119278838 14:73386203-73386225 ACAGCCACTGCACTCCAGCCTGG + Intronic
1119297674 14:73546399-73546421 ACTGCCACTGCACTCTAGCCTGG - Intronic
1119301908 14:73578265-73578287 ACTGCCACTGCACTCTAGCCTGG - Intergenic
1119735975 14:76982403-76982425 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1119811575 14:77525250-77525272 ACAGCCACTGCACTCCAGCCTGG + Intronic
1120866279 14:89297939-89297961 CATGCTACTGCACTCTGGCCTGG + Intronic
1121744033 14:96274058-96274080 ACAGCCCCTGCTTTCTGCCCCGG - Intergenic
1122743815 14:103886651-103886673 ACAGCTTCTGCACTCCAGCCTGG + Intergenic
1122805279 14:104253329-104253351 ACAGCTCCAGCTGTCTGGGCAGG + Intergenic
1122953342 14:105058315-105058337 TGAGCTGCTGCACTCCGGCCTGG + Intronic
1123959562 15:25382275-25382297 AGAGCCACTGCACTGTGGCCTGG + Intronic
1124339679 15:28882252-28882274 AGAGCTACTGCACTCCAGCCTGG + Intergenic
1124530921 15:30505615-30505637 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1124588365 15:31031893-31031915 TCAGCTCATTTACTCTGGCCTGG - Intronic
1124767736 15:32502080-32502102 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1125026211 15:35031928-35031950 AGAGCCACTGCACTCCGGCCTGG + Intergenic
1125084504 15:35714378-35714400 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1125260877 15:37823497-37823519 ACAGAACCTTCATTCTGGCCAGG + Intergenic
1125480512 15:40076203-40076225 ATAGCCACTGCACTCTGGTCTGG - Intergenic
1125526545 15:40379614-40379636 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1125687042 15:41569721-41569743 TGTGCCCCTGCACTCTGGCCTGG + Intronic
1125689726 15:41586260-41586282 ACAGCCACTGCACTCTAGCCTGG - Intergenic
1125720655 15:41843667-41843689 CCAGCTCCCTCAGTCTGGCCGGG - Exonic
1125726529 15:41871133-41871155 ACAGCTCCTGCTCTCAATCCTGG + Intronic
1125744864 15:41991183-41991205 TCTGCTCTTGCGCTCTGGCCAGG - Intronic
1125851878 15:42911887-42911909 ACAGTTCTTCCACTGTGGCCTGG - Intronic
1126009748 15:44291150-44291172 ACAGCTACTGCACTCCAGCCTGG - Intronic
1126010292 15:44296081-44296103 ATAGCTACTGCATTCTAGCCTGG - Intronic
1126650857 15:50920155-50920177 AGCGCCACTGCACTCTGGCCTGG - Intronic
1126774579 15:52089065-52089087 ATAGCTGCTGCACTCCAGCCTGG - Intergenic
1127081891 15:55388718-55388740 ACAGCCACTGCACTCTAGCCTGG + Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127505720 15:59596131-59596153 ACAGCAGCTGGAGTCTGGCCTGG - Intronic
1127950989 15:63806207-63806229 ATAGCCACTGCACTCTAGCCTGG - Intronic
1128017946 15:64363957-64363979 CAAGCCACTGCACTCTGGCCTGG + Intronic
1128059231 15:64723729-64723751 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1128100490 15:64994908-64994930 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1128191483 15:65703797-65703819 ACAGCCACTGCACTCTAGCCTGG + Intronic
1128201444 15:65812160-65812182 AGCGCCACTGCACTCTGGCCTGG - Intronic
1128424961 15:67532524-67532546 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1128470184 15:67945127-67945149 ACCACTACTACACTCTGGCCTGG + Intergenic
1128751405 15:70152715-70152737 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1129020208 15:72509947-72509969 ACAGTCACTGCACTCTAGCCTGG - Intronic
1129039667 15:72675221-72675243 ACTGCACCTGCACTCCAGCCTGG + Intergenic
1129371842 15:75101562-75101584 AGCGCTACTGCACTCTAGCCTGG + Intronic
1129795170 15:78370643-78370665 ATAGCCACTGCACTCTAGCCCGG - Intergenic
1130027153 15:80279902-80279924 ACACGTTCTGCTCTCTGGCCTGG + Intergenic
1130246591 15:82256154-82256176 ACAGCAACTGCACTCCGGCCTGG - Intronic
1130259228 15:82342870-82342892 ACAGCTTCTCCACTCAAGCCTGG + Exonic
1130269448 15:82436295-82436317 ACAGCTTCTCCACTCAAGCCTGG - Exonic
1130335574 15:82954333-82954355 ACTGCCACTGCACTCTAGCCTGG - Intronic
1130454069 15:84087186-84087208 ACAGCAACTGCACTCCAGCCTGG + Intergenic
1130473406 15:84242476-84242498 ACAGCTTCTCCACTCAAGCCTGG - Exonic
1130480820 15:84356540-84356562 ACAGCTTCTCCACTCAAGCCTGG - Intergenic
1130490892 15:84431219-84431241 ACAGCTTCTCCACTCAAGCCTGG + Intergenic
1130502476 15:84510018-84510040 ACAGCTTCTCCACTCAAGCCTGG + Intergenic
1131133312 15:89913548-89913570 ACAGCTCCTGAACTCCTCCCTGG + Intergenic
1131155142 15:90070315-90070337 ATAGCCACTGCACTCTAGCCTGG + Intronic
1131223231 15:90602586-90602608 ATAGCTACTGCACTCCAGCCTGG + Intronic
1131241031 15:90743570-90743592 ACAGCCACTGCACTATAGCCTGG - Intronic
1131256192 15:90864019-90864041 AGAGCTGCTGCACTCCAGCCTGG + Intergenic
1131462384 15:92627006-92627028 AGTGCCACTGCACTCTGGCCCGG + Intronic
1131554941 15:93389220-93389242 TGAGCTACTGCACTCTAGCCTGG + Intergenic
1131874730 15:96792647-96792669 ACAGCCGCTGCACTCCAGCCTGG + Intergenic
1132240533 15:100254050-100254072 ACAGCTCCTCCACTGTGACCAGG + Intronic
1132529985 16:442177-442199 ACAGCCACTGCGCTCCGGCCTGG - Intronic
1132692985 16:1189925-1189947 CCAGCCCCTGGAGTCTGGCCTGG - Intronic
1132747657 16:1443682-1443704 GCAGCTCCACCACCCTGGCCGGG + Exonic
1132881219 16:2162528-2162550 CCAGCTCCGCCACTTTGGCCTGG + Intronic
1133047635 16:3097712-3097734 ACAGCTCCTACTCCCAGGCCAGG - Intronic
1133076453 16:3284109-3284131 GCAGCTCCTGCACCCTGCTCTGG - Exonic
1133124253 16:3634858-3634880 ATAGCCACTGCACTCTAGCCTGG - Intronic
1133534235 16:6685317-6685339 CCAGCCACTGCACTCCGGCCTGG - Intronic
1133745513 16:8683505-8683527 ATAGCTACTGCACTCCAGCCTGG + Intronic
1133809252 16:9148600-9148622 ACACCTCCTGCTGTGTGGCCTGG + Intergenic
1133945959 16:10348746-10348768 TCAGCCACTGCACTCTAGCCTGG - Intronic
1134059338 16:11189499-11189521 ACAGCTCTTGGTCTCTGGCCAGG + Intergenic
1134402052 16:13919545-13919567 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1134473610 16:14551002-14551024 GCACCCACTGCACTCTGGCCTGG - Intronic
1135001961 16:18784208-18784230 ACAGCCACTGCACTCCAGCCTGG + Intronic
1135383246 16:22010875-22010897 CACGCTACTGCACTCTGGCCTGG + Intronic
1135498438 16:22972912-22972934 ACATCTACTGCACTCTAGCCTGG + Intergenic
1135678477 16:24437243-24437265 GGAGCCACTGCACTCTGGCCTGG + Intergenic
1135701987 16:24640683-24640705 CAAGCCACTGCACTCTGGCCTGG + Intergenic
1135746612 16:25022351-25022373 CCAGCTCCTGCCCTCTGGCCAGG - Intergenic
1135755682 16:25095836-25095858 CCAGCTCCTGCACTCTGGCCAGG - Intergenic
1135918291 16:26625486-26625508 ACAGATCATGCACTTTAGCCTGG - Intergenic
1135968848 16:27057660-27057682 AGAGCCACTGCACTCTAGCCTGG - Intergenic
1136315066 16:29449559-29449581 GGAGCTCCTGCACCGTGGCCTGG - Intronic
1136429643 16:30188898-30188920 GGAGCTCCTGCACCGTGGCCTGG - Exonic
1136504520 16:30694429-30694451 ACCGCCACTGCACTCTAGCCTGG - Intergenic
1136637888 16:31537462-31537484 GCTGCTCCTGGGCTCTGGCCAGG - Intergenic
1136778727 16:32884744-32884766 CCCGCTCCTCCCCTCTGGCCCGG - Intergenic
1136853196 16:33630626-33630648 ATAACTCCTGCACTCAAGCCTGG + Intergenic
1136891891 16:33976770-33976792 CCCGCTCCTCCCCTCTGGCCCGG + Intergenic
1136934257 16:34444165-34444187 ATAGCTGCTGCACTCCAGCCTGG - Intergenic
1136970315 16:34967649-34967671 ATAGCTGCTGCACTCCAGCCTGG + Intergenic
1137231265 16:46569656-46569678 ACAGCCGCTGCAGTCCGGCCTGG + Intergenic
1137329867 16:47482761-47482783 ACTGCCACTGCACTCTAGCCTGG - Intronic
1137425039 16:48371240-48371262 ATAGCTACTGCACTCCAGCCTGG + Intronic
1137539064 16:49349674-49349696 ACAGGTCCTGGAAGCTGGCCCGG - Intergenic
1137653112 16:50137073-50137095 CCAGCTACTGCACTCCAGCCTGG + Intergenic
1137896837 16:52222056-52222078 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1137987650 16:53123543-53123565 ACAGCCACTGCATTCTAGCCTGG - Intronic
1138092200 16:54184244-54184266 CAAGCTACTGCACTCTAGCCTGG - Intergenic
1138256883 16:55572787-55572809 ATAGCCACTGCACTCCGGCCTGG + Intronic
1138570468 16:57868572-57868594 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1138656008 16:58491816-58491838 ACACCCCTTGCACTCTAGCCTGG - Intronic
1138672596 16:58627869-58627891 AGAGCTACTGCACTCCAGCCTGG - Intronic
1139417796 16:66828640-66828662 ACAGCCACTGCACTCCAGCCTGG + Intronic
1139619745 16:68128779-68128801 ATAGCCACTGCACTCTAGCCTGG + Intronic
1139794539 16:69471515-69471537 AGAGCCACTGCACTCTTGCCTGG - Intergenic
1139868993 16:70088740-70088762 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1139972944 16:70787490-70787512 TCAGCTCCTCCACTCAGGGCAGG - Intronic
1140256983 16:73346014-73346036 ACAGCTCCCTCATTCTGGCCTGG - Intergenic
1140386395 16:74543432-74543454 ATAGCTACTGCACTCCAGCCTGG + Intronic
1140401277 16:74673906-74673928 ATAGCCACTGCACTCTGGCCTGG + Intronic
1141075586 16:81004177-81004199 GCACCACCTGCACTCTAGCCTGG + Intronic
1141187987 16:81802154-81802176 AGCGCCACTGCACTCTGGCCTGG - Intronic
1141327767 16:83078552-83078574 ACATCTCCTGCTGTCCGGCCAGG + Intronic
1141428380 16:83957793-83957815 CCAGCTCCTGCCCTCAGACCTGG - Intronic
1141929373 16:87191664-87191686 AGTGCCACTGCACTCTGGCCTGG + Intronic
1142052863 16:87970971-87970993 CCTGCCACTGCACTCTGGCCTGG + Intronic
1142357433 16:89608590-89608612 ATAACGCCTGCACTTTGGCCTGG - Intergenic
1203081144 16_KI270728v1_random:1146838-1146860 CCCGCTCCTCCCCTCTGGCCCGG - Intergenic
1203114793 16_KI270728v1_random:1479068-1479090 ATAACTCCTGCACTCAAGCCTGG + Intergenic
1142620287 17:1161284-1161306 TCACATTCTGCACTCTGGCCTGG - Intronic
1142774599 17:2126670-2126692 CAAGCCACTGCACTCTGGCCTGG + Intronic
1142784416 17:2209406-2209428 CGTGCTACTGCACTCTGGCCTGG - Intronic
1142832181 17:2557498-2557520 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1142834036 17:2571345-2571367 CGAGCTACTGCACTCTAGCCTGG + Intergenic
1142838449 17:2607526-2607548 GGTGCTGCTGCACTCTGGCCTGG - Intronic
1142846479 17:2681190-2681212 ACAGCCACTGCACTCCAGCCTGG + Intronic
1142849347 17:2696749-2696771 CCAGCTCCTTCACCTTGGCCAGG + Exonic
1142895442 17:2974303-2974325 AGCGCCACTGCACTCTGGCCTGG + Intronic
1143086577 17:4420627-4420649 ACTGCTACTGCACTCCAGCCTGG + Intergenic
1143094867 17:4473439-4473461 ATCGCACCTGCACTCTGGCCTGG - Intronic
1143528445 17:7485758-7485780 TCAGCCATTGCACTCTGGCCTGG - Intronic
1143952681 17:10646096-10646118 TGAGCTCCTGCACCCTGGGCTGG + Intronic
1144043537 17:11434105-11434127 TGTGCTACTGCACTCTGGCCTGG - Intronic
1144385121 17:14742313-14742335 CGAGCTACTGCACTCTAGCCCGG - Intergenic
1144403351 17:14928098-14928120 CGAGCCGCTGCACTCTGGCCTGG + Intergenic
1144512220 17:15886941-15886963 ACACCTCCTGCCCCCTGGCTGGG - Intergenic
1144552886 17:16257059-16257081 ACTGCCACTGCACTCTAGCCTGG + Intronic
1144742183 17:17590157-17590179 ACAGCTCCTGCATTTTCACCAGG - Intronic
1145123598 17:20282043-20282065 ACACCTCCTGCCCCCTGGCTGGG - Intronic
1145221875 17:21096227-21096249 ACTGCCACTGCACTCTAGCCTGG + Intergenic
1145753455 17:27372361-27372383 ACTGCCACTGCACTCTAGCCTGG + Intergenic
1146115158 17:30130137-30130159 AGAGCCACTGCACTCTAGCCTGG - Intronic
1146386027 17:32374259-32374281 CGTGCTACTGCACTCTGGCCTGG - Exonic
1146722949 17:35136204-35136226 TCAACTCCTGCACTGTGACCAGG + Exonic
1146998904 17:37346032-37346054 GGAGCCCCTGCACTCTGGCCTGG + Intronic
1147055592 17:37832368-37832390 CCCGCTACTGCACTCTAGCCTGG - Intergenic
1147391990 17:40115122-40115144 ACAGCTACTGGACTCCAGCCTGG + Intergenic
1147521875 17:41181165-41181187 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1147793682 17:43028138-43028160 ACAGCTCCCTCAGTGTGGCCAGG - Exonic
1148020351 17:44549112-44549134 CCTGCCACTGCACTCTGGCCTGG - Intergenic
1148059741 17:44827818-44827840 CCAGCCACTGCACTCTAGCCTGG + Intronic
1148098780 17:45074256-45074278 CCAGCCACTGCACTCCGGCCTGG - Intronic
1148147500 17:45375218-45375240 CCTGCTACTGCACTCTAGCCTGG - Intergenic
1148224205 17:45887099-45887121 ACACCTACTGCACTCCAGCCTGG - Intergenic
1148569691 17:48658387-48658409 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1148657309 17:49296693-49296715 ATAGCCACTGCACTCTAGCCTGG + Exonic
1149263411 17:54902335-54902357 AGAGCTACTGCACTCCAGCCTGG - Intronic
1149270927 17:54976607-54976629 TCACCTCCTGCCGTCTGGCCGGG - Intronic
1149479010 17:56986587-56986609 AGCGCCACTGCACTCTGGCCTGG - Intronic
1149674041 17:58442949-58442971 ACTGCCACTGCACTCTAGCCTGG - Intronic
1149907857 17:60543107-60543129 ATAGCCACTGTACTCTGGCCTGG + Intergenic
1150100905 17:62422832-62422854 CCGGCTACTGCACTCTAGCCTGG + Intergenic
1150241806 17:63640245-63640267 ATAGCTACTGCACTCCAGCCTGG + Intronic
1150322619 17:64228703-64228725 ACCGCTCCTGGTCTGTGGCCCGG + Intronic
1150333846 17:64315848-64315870 ACAGCTACTGCACTCCAGCCTGG + Intergenic
1150361656 17:64540294-64540316 ATAGCTACTGCACTCCAGCCTGG + Intronic
1150699316 17:67433856-67433878 ATAGCCACTGCACTCTAGCCTGG + Intronic
1151711122 17:75807352-75807374 ACAGCCACTGCACTCCAGCCTGG + Intronic
1151714287 17:75823570-75823592 CCAGCTCTTGGACTCTGACCTGG + Intronic
1151753815 17:76059203-76059225 CAAGCTACTGCACTCTGGCCTGG + Intronic
1151797863 17:76358470-76358492 ACAGCCACTGCACTCCAGCCTGG + Intronic
1151852221 17:76697758-76697780 CCAGCTACTGCAGCCTGGCCGGG - Intronic
1152177694 17:78798625-78798647 GCAGGTCCTGCACACAGGCCGGG + Intronic
1152181748 17:78826401-78826423 CCAGCTACTGCACTCCAGCCTGG + Intronic
1152224678 17:79087230-79087252 GCAGCTCCTGCACTCAGGCTGGG - Intronic
1152408107 17:80108774-80108796 GCAGCTCCTGCACCATGGCCGGG - Intergenic
1152649375 17:81484766-81484788 AGTGCTCCTTCCCTCTGGCCAGG - Intergenic
1153019215 18:611529-611551 ATAGCCACTGCACTCTAGCCTGG + Intronic
1153077207 18:1177134-1177156 AGAGCCACTGCACTCCGGCCTGG - Intergenic
1153294354 18:3531524-3531546 GCAGCTACTGCACTCCAGCCTGG - Intronic
1153623625 18:7003292-7003314 AATGCCTCTGCACTCTGGCCTGG - Intronic
1154155292 18:11939583-11939605 CGTGCTACTGCACTCTGGCCTGG - Intergenic
1154263978 18:12863413-12863435 CCTGCTACTGCACTCTAGCCTGG + Intronic
1154363318 18:13683518-13683540 ACAGCTACTCCACTCCAGCCTGG + Intronic
1154989566 18:21588054-21588076 ACAGCCACTGCACTCCAGCCCGG + Intronic
1155020689 18:21894084-21894106 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1155114535 18:22751688-22751710 ACAGCTCCTGAGCTCTAGACAGG + Intergenic
1155143138 18:23061384-23061406 AACGCCACTGCACTCTGGCCTGG - Intergenic
1155950095 18:31902285-31902307 AGTGCCACTGCACTCTGGCCTGG + Intronic
1156316119 18:35970717-35970739 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1156332530 18:36137207-36137229 ACAGCCACTGCACTCCAGCCTGG - Intronic
1156338693 18:36190973-36190995 TGAGCCCCTGCACTCTAGCCTGG + Intronic
1156697608 18:39785892-39785914 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1157350869 18:46884354-46884376 CGAGCCACTGCACTCTGGCCTGG - Intronic
1157645719 18:49267851-49267873 CCTGCCACTGCACTCTGGCCTGG + Intronic
1157687905 18:49657543-49657565 ATAGTTACTGTACTCTGGCCAGG + Intergenic
1158188091 18:54794745-54794767 ACTGCTCCTGCACTCTAAACGGG - Intronic
1158383621 18:56964412-56964434 ACACCTTCTGTACTCTAGCCTGG - Intronic
1158426738 18:57347175-57347197 ACATCTCCAGCTCTCTGACCTGG + Intergenic
1158431560 18:57392209-57392231 TGAGCCCCTGCACTCCGGCCTGG + Intergenic
1158433715 18:57417542-57417564 CGCGCTACTGCACTCTGGCCTGG - Intergenic
1158519890 18:58163108-58163130 AAAGCTACTGCACTCTAGCCTGG - Intronic
1158589415 18:58767341-58767363 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1158658094 18:59359196-59359218 ACAGCGGCCGAACTCTGGCCCGG + Exonic
1159013423 18:63081210-63081232 ATAGCCCCTGCACTCCAGCCTGG + Intergenic
1159166000 18:64701600-64701622 ACAGCTCTTCCACTCTCTCCAGG + Intergenic
1160048718 18:75411622-75411644 CCAGCTCCAGCACGCTGGCATGG + Intronic
1160078656 18:75702748-75702770 ACAGCTGCTGCTTTCTGTCCTGG - Intergenic
1161247923 19:3264758-3264780 CACGCTACTGCACTCTGGCCTGG - Intronic
1161318787 19:3631603-3631625 GCAGCCCCTCCACTCTGCCCAGG - Exonic
1161655964 19:5515110-5515132 AGCTCTCCTGCCCTCTGGCCTGG + Intergenic
1161719847 19:5896702-5896724 ACAGCTCCAGGACTGGGGCCAGG - Intronic
1162008062 19:7792565-7792587 GCAGGTCATGCTCTCTGGCCAGG + Intergenic
1162009194 19:7801468-7801490 GCAGGTCATGCCCTCTGGCCTGG + Intergenic
1162047139 19:8007514-8007536 ACAGCCACTGCACTCCAGCCTGG - Intronic
1162303938 19:9860102-9860124 ACTGCACCTGCACTCCAGCCTGG + Intronic
1162330854 19:10028561-10028583 CCTGCCACTGCACTCTGGCCTGG - Intergenic
1162422020 19:10571044-10571066 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1162476238 19:10901349-10901371 ACAGCCACTGCACTCCAGCCTGG - Intronic
1162503844 19:11070634-11070656 CCAGCCACTGCACTCTAGCCTGG - Intergenic
1162580587 19:11527646-11527668 ATAGCCACTGCACTCTAGCCTGG + Intronic
1162598601 19:11649130-11649152 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1162708129 19:12571274-12571296 AGCGCCACTGCACTCTGGCCTGG - Intronic
1163146438 19:15382247-15382269 AGAGCCCCTGCACTCCAGCCTGG - Intronic
1163239135 19:16048591-16048613 CACGCTACTGCACTCTGGCCTGG + Intergenic
1163532464 19:17858482-17858504 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1163564702 19:18043976-18043998 TTACCTCCGGCACTCTGGCCAGG - Intergenic
1163708695 19:18832611-18832633 CCAGGTCCTGCAATCTGCCCGGG + Intronic
1163808704 19:19416804-19416826 AGAGCCATTGCACTCTGGCCTGG - Intronic
1164021030 19:21305491-21305513 ACAGCCACTGCACTCCAGCCTGG - Intronic
1164208529 19:23077479-23077501 ACTGCTACTGCACTCCAGCCTGG - Intronic
1164510829 19:28895875-28895897 TCCGCTCCTGCACTCTGGCATGG - Intergenic
1164553628 19:29233114-29233136 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1164735826 19:30540217-30540239 ACAGCTCCTGGATGCTGGCTGGG + Intronic
1165016432 19:32884013-32884035 ACAGCCACTGCACTCCAGCCTGG - Intronic
1165197629 19:34117340-34117362 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1165259869 19:34603838-34603860 ATAGCCCCTGCACTCCAGCCTGG - Intronic
1165273270 19:34728413-34728435 ATAGCTCCTGCACTCCAGCCTGG + Intergenic
1165317295 19:35064582-35064604 CCTGCCACTGCACTCTGGCCTGG + Intronic
1165361420 19:35339192-35339214 CCTGCTACTGCACTCTAGCCTGG + Intronic
1165679418 19:37761150-37761172 ACTGCACCTGCACTCTAGCCTGG + Intronic
1165680426 19:37769680-37769702 CAAGCCACTGCACTCTGGCCCGG + Intronic
1165704050 19:37962510-37962532 CCTGCCACTGCACTCTGGCCTGG - Intronic
1165705827 19:37975598-37975620 ACAGCTCCTGGCCTGTGGCAAGG + Intronic
1166968598 19:46546844-46546866 GCAGCTACTGCACTCCAGCCTGG - Intronic
1167126297 19:47551402-47551424 ATAACCCCTGCACTCTAGCCTGG - Intronic
1167402884 19:49284576-49284598 CCAGCTACTGCACTCCAGCCTGG + Intergenic
1167411460 19:49346611-49346633 ACAGCCACTGCACTCCAGCCTGG + Intronic
1168034680 19:53709947-53709969 ATAGCCACTGCACTCCGGCCTGG + Intergenic
1168220125 19:54954484-54954506 AGTGCCACTGCACTCTGGCCTGG + Intronic
1168230977 19:55031401-55031423 ACAGCCACTGCACTCCGGCCTGG + Intronic
1168650645 19:58090048-58090070 ACAGCTCATGCAGCCGGGCCAGG + Exonic
925052398 2:827192-827214 AGCGCCACTGCACTCTGGCCTGG - Intergenic
925502046 2:4515588-4515610 AAAGTTCCTGCTCTATGGCCAGG + Intergenic
925850019 2:8071664-8071686 CGCGCTACTGCACTCTGGCCTGG - Intergenic
925942644 2:8835614-8835636 ACACCACCTGCACTCCAGCCTGG + Intronic
925974018 2:9128204-9128226 ATCGCTCCTGCACTCCAGCCTGG + Intergenic
926042767 2:9687944-9687966 ATAGCAACTGCACTCCGGCCTGG + Intergenic
926163261 2:10502621-10502643 TCAGCTCCAGCAGCCTGGCCCGG + Intergenic
926163930 2:10506341-10506363 CAAGCCACTGCACTCTGGCCTGG + Intergenic
927669628 2:25058283-25058305 ATAGCCACTGCACTCTAGCCTGG + Intronic
927788045 2:25987646-25987668 ACACCACTTGCACTCTAGCCTGG + Intergenic
928092180 2:28381740-28381762 GCACCTCCCTCACTCTGGCCTGG - Intergenic
928278184 2:29921117-29921139 CCAGCTGCTGCACGCTGTCCTGG + Exonic
928606495 2:32948243-32948265 CCAGCTCCTGTTCTGTGGCCTGG + Intronic
928620356 2:33082490-33082512 ATCGCACCTGCACTCTGGCCTGG - Intronic
928957247 2:36882415-36882437 ATAGCTACTGCACTCCAGCCTGG - Intronic
929258387 2:39838769-39838791 ACAGCACCTGAACTCAGGGCTGG - Intergenic
929476139 2:42251107-42251129 TCACCTCCTGCTGTCTGGCCTGG + Intronic
929523956 2:42682144-42682166 GCTGCTGCTGCACTCTAGCCTGG + Intronic
929524643 2:42690121-42690143 ATAGCTACTGCACTCCAGCCTGG + Intronic
929725328 2:44419822-44419844 ATAGCCACTGCACTCTAGCCTGG + Intronic
930122092 2:47768604-47768626 ACAGCTACTGTACTCCAGCCTGG + Intronic
930553999 2:52871613-52871635 ACAGCCACTGCACTCCAGCCTGG + Intergenic
930746185 2:54885653-54885675 AGCGCCACTGCACTCTGGCCTGG - Intronic
930795060 2:55380657-55380679 CATGCTGCTGCACTCTGGCCTGG - Intronic
931341970 2:61410467-61410489 TCAGCTCCTGCTGTGTGGCCTGG + Intronic
931915964 2:66956463-66956485 ACTGCCACTGCACTCTAGCCTGG + Intergenic
931924493 2:67056744-67056766 CCTGCCCCTGCACTCTAGCCTGG - Intergenic
932182763 2:69663622-69663644 ACAGCCACTGCACTCTAGCCTGG + Intronic
932190468 2:69737639-69737661 ACAGCCACTGCACTCTAGCCTGG - Intronic
932598265 2:73107585-73107607 GCAGCTCCTCCTCTCTGGCCTGG - Intronic
932780548 2:74556069-74556091 ACAGCCCCTGCACCTTGTCCCGG - Exonic
932907304 2:75767775-75767797 ACAGCTCTTGCCTTCTGGCAAGG - Intergenic
932945029 2:76219679-76219701 AGCGCCACTGCACTCTGGCCTGG - Intergenic
934728997 2:96644436-96644458 AGCGCCACTGCACTCTGGCCTGG + Intergenic
934794136 2:97086094-97086116 GCCTCTGCTGCACTCTGGCCTGG + Intronic
935226305 2:101055939-101055961 ACAGCCACTGCACTCCAGCCTGG + Intronic
936060329 2:109291411-109291433 TCAGTTCCTGCAATCTCGCCTGG + Intronic
936106490 2:109629156-109629178 CCTGCCACTGCACTCTGGCCTGG + Intergenic
936268921 2:111033493-111033515 ACAGCTCGTGTCCTCAGGCCTGG + Intronic
936396323 2:112134623-112134645 ATTGCTACTGCACTCTAGCCTGG - Intergenic
936545574 2:113389611-113389633 TGAGCTACTGCACTCTAGCCTGG + Intergenic
936574058 2:113638846-113638868 ACCGCCACTGCACTCTAGCCTGG + Intronic
936628442 2:114174414-114174436 CCCGCTGCTGCACTCTAGCCTGG - Intergenic
936785288 2:116087369-116087391 ACAGGTACTGCACTTTGGCGAGG + Intergenic
937382231 2:121389904-121389926 ACAGCTACTGCACTCCAGCCTGG - Intronic
937454807 2:122032045-122032067 ACAGTTCCTGGACTGTCGCCAGG - Intergenic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938028911 2:127974767-127974789 TGAGCTACTGCACTCTAGCCTGG + Intronic
938316555 2:130333366-130333388 AGCGCTACTGCACTCTAGCCTGG - Intergenic
938390098 2:130898300-130898322 TCAAATCCTGCACTCAGGCCTGG + Intronic
938545497 2:132325804-132325826 ATAGCCACTGCACTCTAGCCTGG + Intergenic
938870791 2:135474145-135474167 AGCACCCCTGCACTCTGGCCTGG + Intronic
939531172 2:143363449-143363471 TGAGCCACTGCACTCTGGCCTGG + Intronic
940232633 2:151473335-151473357 GCCCCACCTGCACTCTGGCCTGG - Intronic
940654779 2:156475064-156475086 TGAGCCACTGCACTCTGGCCTGG + Intronic
940820046 2:158343050-158343072 ACAGCCACTGCACTCTAGCCTGG - Intronic
940863063 2:158790074-158790096 ACAGCCACTGCACTCCAGCCTGG + Intergenic
940923308 2:159334944-159334966 ACAGCCACTGCACTATAGCCTGG - Intronic
941740669 2:169031804-169031826 ACAACTCTTGCACCCTGGCATGG + Intergenic
941979536 2:171439992-171440014 AAAGCCACTGCACTCTAGCCTGG - Intronic
942045084 2:172095355-172095377 GCAGCTTGTGCGCTCTGGCCCGG + Intergenic
942166230 2:173243659-173243681 AGCGCCACTGCACTCTGGCCTGG - Intronic
942524595 2:176839827-176839849 AATGCTCATGCACTCTGACCTGG + Intergenic
943488764 2:188522030-188522052 AGCGCCACTGCACTCTGGCCTGG + Intronic
944307624 2:198195851-198195873 ACAGCTCCTTCACTCTCTCTTGG - Intronic
944803424 2:203258342-203258364 ATAGCCCCTGCACTCCTGCCTGG + Intronic
944837376 2:203593105-203593127 CCAGCTGCTGCACTCCAGCCTGG - Intergenic
945131972 2:206583408-206583430 AGTGCCACTGCACTCTGGCCTGG + Intronic
945251302 2:207768341-207768363 GCAGCTCATGCGCTCGGGCCAGG + Exonic
945437594 2:209837813-209837835 AGCGCCACTGCACTCTGGCCTGG - Intronic
945639715 2:212408608-212408630 ATAGCCACTGCACTCTAGCCTGG + Intronic
946146521 2:217735231-217735253 TCACCTCCTGCTCTGTGGCCTGG + Intronic
946288926 2:218728522-218728544 TCAGCTCCTGCTGTGTGGCCTGG + Intronic
946345052 2:219102681-219102703 ATAGCTACTGCACTCTAGCCTGG + Intronic
947390576 2:229635256-229635278 AGACCTCCAGCCCTCTGGCCAGG + Intronic
948128554 2:235583236-235583258 ATGGCTGCTGCACTCTGGCCTGG - Intronic
948292633 2:236837468-236837490 ACAGAGTCTGCACTCTGGACTGG + Intergenic
948602426 2:239115064-239115086 GCAGCTCCTGCTCACTGGGCTGG + Exonic
948858960 2:240743669-240743691 GCAGCCCCTGCACACTGCCCAGG + Intronic
948895769 2:240926203-240926225 CCTGCTCCTGAAGTCTGGCCAGG - Intronic
949064823 2:241983704-241983726 GCGGCTCCTGCCCCCTGGCCAGG + Intergenic
1168795660 20:608968-608990 GCAGCTCCTGCAATGTGTCCTGG - Intronic
1169259978 20:4130104-4130126 AGTGCCACTGCACTCTGGCCTGG + Intronic
1169298467 20:4421110-4421132 GCCACTGCTGCACTCTGGCCTGG - Intergenic
1169711354 20:8567688-8567710 ATAGCCACTGCACTCTAGCCTGG + Intronic
1170846176 20:19963905-19963927 AGAGCCACTGCACTCTAGCCTGG - Intronic
1170970426 20:21110972-21110994 ACAGCCCCTGCACTTCAGCCTGG - Intergenic
1171223820 20:23424035-23424057 TGAGCCACTGCACTCTGGCCTGG - Intergenic
1171251783 20:23654419-23654441 ACAGCCCTTGGACTCTTGCCTGG - Intergenic
1171508640 20:25661100-25661122 TCACCTCCTGCTCTGTGGCCCGG + Intergenic
1171741110 20:28889672-28889694 ACTGCTGCTGCACTCCAGCCTGG - Intergenic
1171750556 20:29044605-29044627 ACAGCCCCTGCACTCCAGGCTGG + Intergenic
1171797042 20:29574688-29574710 GCAGCTACTGCAGTGTGGCCTGG + Intergenic
1171874354 20:30558560-30558582 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1171906485 20:30903868-30903890 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1171982343 20:31637152-31637174 CCGGCTACTGCACTCTAGCCTGG - Intergenic
1172366739 20:34355797-34355819 ACTGATCCTGCATTCTGACCAGG + Intergenic
1173015121 20:39218493-39218515 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1173612500 20:44380336-44380358 CCTGCTGCTGCACTCTAGCCTGG - Intronic
1173928147 20:46796353-46796375 AGTGCCGCTGCACTCTGGCCTGG - Intergenic
1174242176 20:49145857-49145879 ACAGCCACTGCACTCCAGCCTGG + Intronic
1174324752 20:49770371-49770393 AGTGCCACTGCACTCTGGCCTGG + Intergenic
1174628235 20:51933565-51933587 ACTGCTACTGCACTCCAGCCTGG - Intergenic
1175120826 20:56715108-56715130 ACGGGGCCTGCTCTCTGGCCGGG + Intergenic
1175233407 20:57491077-57491099 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1176314651 21:5231311-5231333 ACAGCCCCTGCACTCCAGGCTGG - Intergenic
1176862165 21:14016639-14016661 CATGCTACTGCACTCTGGCCTGG + Intergenic
1177581542 21:23029614-23029636 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1178076151 21:29014775-29014797 ACAGCCACTGCACTCCAGCCTGG + Intronic
1178275061 21:31229691-31229713 ACTGCTACTGCACTCCAGCCTGG - Intronic
1178417676 21:32416997-32417019 ATAGCCACTGCACTCGGGCCTGG - Intronic
1178488848 21:33035263-33035285 GCAGCAGCTGCACTCTGGGCAGG - Intergenic
1178497204 21:33097277-33097299 GCAGCCACTGCACTCTAGCCTGG - Intergenic
1178547946 21:33509214-33509236 ATAGCTACTGTACTCTAGCCTGG + Intronic
1178744635 21:35237119-35237141 TCACCTCCTGCAGTATGGCCTGG - Intronic
1178847112 21:36183062-36183084 ACAGCTCCTGCACTCTGGCCTGG - Intronic
1179517723 21:41920192-41920214 ACAGCTCCTGGATTTGGGCCTGG + Intronic
1179657750 21:42855702-42855724 CCAGCTCCTGCAGACTGGCCAGG + Exonic
1179878107 21:44281714-44281736 CCTGCTCCTGCAGCCTGGCCAGG - Intergenic
1180689257 22:17697870-17697892 CAAGCCACTGCACTCTGGCCTGG - Intronic
1180786536 22:18550778-18550800 CCAGCTGCTGCCCCCTGGCCTGG - Intergenic
1180920745 22:19520264-19520286 AGAGCTCCTGCCCCCTGGCCCGG - Intronic
1181131815 22:20736501-20736523 CCAGCTGCTGCCCTCTGGCCTGG - Intronic
1181243456 22:21490331-21490353 CCAGCTGCTGCCCCCTGGCCTGG - Intergenic
1182148974 22:28015285-28015307 TCAGCACCTGCCCTGTGGCCTGG + Intronic
1182381276 22:29890472-29890494 TAAGCTGCTGCACTCTAGCCTGG + Intronic
1183119782 22:35721500-35721522 ACCACTACTGCACTCTAGCCTGG + Intronic
1183216623 22:36484424-36484446 AGTGCCACTGCACTCTGGCCTGG + Intergenic
1183510523 22:38231954-38231976 ACAGCCACTGCACTCCAGCCTGG + Intronic
1183527328 22:38331193-38331215 AGAGCCACTGCACTCTAGCCTGG - Intronic
1183580259 22:38720947-38720969 CGAGCTACTGCACTCTAGCCTGG - Intronic
1183788510 22:40045558-40045580 GCAGGTCCTGCACACAGGCCGGG - Intronic
1184363632 22:44034424-44034446 ACAGCCACTGCACTCCAGCCTGG - Intronic
1184374428 22:44102805-44102827 ATAGCCACTGCACTCTAGCCTGG + Intronic
1184498255 22:44856313-44856335 TCAGCCACTGCACTCTGGCCTGG - Intronic
1184678565 22:46056478-46056500 ACAGCTCCGTCACCGTGGCCGGG + Intronic
1184975323 22:48057665-48057687 ACAGTTCCTGCAGTGTGGCCCGG + Intergenic
1185061523 22:48609562-48609584 ACAGCTCCTGAACCCAGGACGGG + Intronic
1185142676 22:49112022-49112044 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1185269405 22:49922077-49922099 ACAGATGCTGCTCTCTGGGCCGG - Intronic
1185332009 22:50256181-50256203 ACAGATCCTGGACTTCGGCCTGG - Exonic
1185426115 22:50772046-50772068 ACCGCCACTGCACTCTAGCCTGG - Intronic
949493799 3:4612841-4612863 CCTGCTCCTGCACTCCAGCCTGG + Intronic
949566824 3:5252950-5252972 ATAGCTACTGCACTCCAGCCTGG - Intergenic
949690885 3:6637355-6637377 AGCGCCACTGCACTCTGGCCTGG + Intergenic
950016621 3:9759089-9759111 TCAGCCCCTCCAGTCTGGCCAGG + Intronic
950238172 3:11341741-11341763 ATATCTCCTGCGCTCAGGCCAGG - Intronic
950326027 3:12110661-12110683 ACAGCACAGGGACTCTGGCCCGG + Intronic
950411091 3:12838066-12838088 ACAGCCACTGCACTGTAGCCAGG + Intronic
950414698 3:12862213-12862235 ACAGCTCCTGAGGCCTGGCCTGG - Intronic
951058506 3:18175584-18175606 ACAGCCACTGCACTCCAGCCTGG + Intronic
951377100 3:21932121-21932143 AGCGCCCCTGCACTCCGGCCTGG + Intronic
951460502 3:22946236-22946258 AGCGCCACTGCACTCTGGCCTGG + Intergenic
951793830 3:26516440-26516462 CGTGCTGCTGCACTCTGGCCTGG + Intergenic
951982090 3:28576422-28576444 TCAGCGCCTGCACTCTCGCCGGG - Intergenic
952261054 3:31740732-31740754 AGAGCTACTGCACTCCAGCCTGG + Intronic
952417568 3:33103260-33103282 ATAGCTGCTGCACTTTAGCCTGG + Intergenic
952597010 3:35029687-35029709 CCATCTCCTTCTCTCTGGCCTGG + Intergenic
952828944 3:37547046-37547068 ACTGCCCCTGCACTCTGCCTGGG - Intronic
952940403 3:38439716-38439738 AGCGCCACTGCACTCTGGCCTGG + Intergenic
953138899 3:40209258-40209280 ATAGCTACTGCACTCCAGCCTGG + Intronic
953164804 3:40455512-40455534 ATAGCTACTGCACTCCAGCCTGG + Intergenic
953523794 3:43669768-43669790 AGTGCCACTGCACTCTGGCCTGG - Intronic
953581337 3:44159927-44159949 TCAGCTGCTGCAGTCTGCCCTGG + Intergenic
953651093 3:44804938-44804960 ATAGCCACTGCACTCTAGCCTGG + Intronic
953765992 3:45742924-45742946 ATAGCCACTGCACTCTAGCCTGG + Intronic
953991838 3:47489834-47489856 ACTGCCACTGCACTCTAGCCTGG - Intergenic
954045751 3:47928618-47928640 ACAGCTACTGCACTCCAACCTGG + Intronic
954078498 3:48198557-48198579 ACCACTGCTGCACTCTGGCCTGG - Intergenic
954167667 3:48773385-48773407 ACCGCCCCTGCACTCCAGCCTGG - Intronic
954256159 3:49408113-49408135 GGCGCTACTGCACTCTGGCCCGG + Intronic
954282550 3:49592705-49592727 AGCGCCGCTGCACTCTGGCCCGG + Intronic
954285166 3:49614101-49614123 CAAGCCACTGCACTCTGGCCTGG - Intronic
954423171 3:50429455-50429477 AAAAATCCTGAACTCTGGCCGGG + Intronic
954603336 3:51889486-51889508 CCAGCTACTGCACTCCAGCCTGG + Intergenic
954889233 3:53908770-53908792 ATAGCCACTGCACTCTAGCCTGG + Intergenic
955382182 3:58448206-58448228 ACTGCCACTGCACTCCGGCCTGG + Intergenic
956111665 3:65876287-65876309 ACAGCCACTGCACTCCAGCCTGG + Intronic
957376356 3:79364159-79364181 ACACCCACTGCACTCTAGCCTGG + Intronic
957641813 3:82862742-82862764 TGAGCCACTGCACTCTGGCCTGG + Intergenic
957935508 3:86936605-86936627 CCAGCCACTGCACTCTAGCCTGG + Intergenic
958772957 3:98448274-98448296 ACAGCCACTGCACTCCAGCCTGG - Intergenic
958797166 3:98718046-98718068 CATGCTACTGCACTCTGGCCTGG - Intergenic
959380132 3:105631620-105631642 CCAGCTACTGCACTCCAGCCTGG + Intergenic
960823417 3:121758125-121758147 ACACCTCCTGCTGTGTGGCCTGG + Intergenic
961152659 3:124652618-124652640 AGTGCCACTGCACTCTGGCCTGG - Intronic
961724769 3:128920358-128920380 AGTGCTACTGCACTCTAGCCTGG + Intronic
961792072 3:129383472-129383494 AGAGCTGCTGAGCTCTGGCCAGG + Intergenic
962120192 3:132553058-132553080 AGTGCCACTGCACTCTGGCCTGG - Intergenic
962527856 3:136252299-136252321 TGAGCTGCTGCACTCTAGCCTGG - Intronic
963451927 3:145492876-145492898 ACAGTTCTTGCAGTCTGGACTGG - Intergenic
963602802 3:147392245-147392267 ACAGCTGCTGCTGTCAGGCCAGG + Intronic
963603766 3:147397445-147397467 ACTGCTCATGCGCTCTGACCCGG + Intronic
963806338 3:149726721-149726743 AAAGCCACTGCACTCTAGCCTGG - Intronic
963868887 3:150392290-150392312 ATAGCCACTGCACTCTAGCCTGG - Intergenic
963934987 3:151043039-151043061 TCAGCCACTGAACTCTGGCCTGG + Intergenic
964124837 3:153225385-153225407 CGCGCTACTGCACTCTGGCCTGG + Intergenic
964344292 3:155740361-155740383 AGATCTACTGCACTCTAGCCTGG + Intronic
965782504 3:172301812-172301834 GCAGCTGCTGCACTCCAGCCTGG + Intronic
965816924 3:172646309-172646331 AGAGCCACTGTACTCTGGCCTGG + Intronic
965838015 3:172872250-172872272 ACAGTTCCTTCACTCTGGACAGG - Intergenic
967038589 3:185667441-185667463 ACAGCTACTGCACTCCAGCCTGG + Intronic
967116704 3:186347403-186347425 ACAGCCGCTGCACTCCAGCCTGG + Intronic
967143000 3:186579047-186579069 ATAGCCACTGCACTCTAGCCTGG + Intronic
967860268 3:194145925-194145947 ACAGCCACTGCACTCTAGCCTGG + Intergenic
968615471 4:1575735-1575757 CCAGCTCCTGCTCTCTGGCAAGG - Intergenic
968617557 4:1585768-1585790 ATTGCTACTGCACTCTAGCCTGG - Intergenic
968701659 4:2060529-2060551 AGAGCTCCCGGACGCTGGCCAGG + Intronic
968797528 4:2717709-2717731 ACGGCACTTGCACTCTAGCCTGG + Intronic
968884325 4:3319244-3319266 GCAGCCACTGCACTCTAGCCTGG + Intronic
968945712 4:3662611-3662633 ACAGCCCCTGCACTGCGTCCCGG + Intergenic
969383948 4:6830451-6830473 ATCGCCCCTGCACTCTAGCCTGG - Intronic
969931233 4:10632979-10633001 CACGCCCCTGCACTCTGGCCTGG - Intronic
970106469 4:12591508-12591530 AGTGCCACTGCACTCTGGCCTGG + Intergenic
970122409 4:12771373-12771395 TGAGCCACTGCACTCTGGCCTGG - Intergenic
970272540 4:14362809-14362831 ACTGCACCTGCACTCCTGCCTGG - Intergenic
970517161 4:16844202-16844224 CCAGCCACTGCACTCTAGCCTGG + Intronic
970633583 4:17981697-17981719 CACGCTCCTGCACTCTAGCCTGG + Intronic
970804615 4:20016426-20016448 ACCACCACTGCACTCTGGCCTGG - Intergenic
970828370 4:20305827-20305849 AATGCCACTGCACTCTGGCCTGG + Intronic
970867473 4:20775661-20775683 ATTGCTGCTGCACTCTAGCCTGG + Intronic
971105125 4:23516130-23516152 CCCGCCACTGCACTCTGGCCTGG + Intergenic
971299413 4:25429411-25429433 ACACAACCTGCACTCTAGCCTGG + Intergenic
971454656 4:26832948-26832970 TGAGCTACCGCACTCTGGCCTGG + Intergenic
971781394 4:31039427-31039449 ACAGCCACTGCACTCCAGCCTGG - Intronic
971977967 4:33715368-33715390 TCGGCCACTGCACTCTGGCCTGG - Intergenic
972670469 4:41210138-41210160 TCACCTCCTGCTCTATGGCCCGG + Intronic
972774863 4:42231283-42231305 AGCGCCACTGCACTCTGGCCTGG - Intergenic
973624297 4:52756187-52756209 ATAGCCACTGCACTCTAGCCTGG - Intergenic
973977329 4:56275419-56275441 ATAGCTACTGCACTCTAGCCTGG + Intronic
974033152 4:56794372-56794394 ACAGCCACTGCACTCCAGCCTGG - Intergenic
974034538 4:56806086-56806108 ACAGCTACTGCACTCCAGCCTGG + Intergenic
974906710 4:68066888-68066910 AGTGCCACTGCACTCTGGCCTGG + Intronic
975338998 4:73216030-73216052 ACAGCCACTGCACTCCAGCCTGG + Intronic
975697265 4:77025499-77025521 CCTGCTCCTGCACTCCAGCCTGG + Intronic
975709388 4:77144738-77144760 CGAGCCACTGCACTCTGGCCTGG - Intergenic
975775384 4:77780928-77780950 ATAGCCACTGCACTCTAGCCTGG + Intronic
976244674 4:82995254-82995276 AGTGCCACTGCACTCTGGCCTGG + Intronic
976343346 4:83970072-83970094 ATAGCCCCTGCACTCCAGCCTGG + Intergenic
976564972 4:86542568-86542590 ATAGCCACTGCACTCTAGCCTGG + Intronic
976815105 4:89138909-89138931 ACACCTACTGCACTCCAGCCTGG + Intergenic
977305981 4:95324150-95324172 ACACCTCCTGCCATGTGGCCCGG - Intronic
977905056 4:102467735-102467757 ACAGCTCAAGCACTCTGGTGAGG - Intergenic
979559606 4:122087533-122087555 ATAGCCACTGCACTTTGGCCTGG - Intergenic
980093781 4:128468665-128468687 ACAGCTCCTGAAATCATGCCAGG - Intergenic
980271433 4:130589669-130589691 ACAGCCACTGCACTCCAGCCTGG - Intergenic
980300726 4:130988242-130988264 ATAGCCACTGCACTCTTGCCTGG - Intergenic
980303356 4:131023319-131023341 CCCGCCACTGCACTCTGGCCTGG + Intergenic
980306402 4:131065677-131065699 ACACCTCCTGCACTGCAGCCTGG + Intergenic
980365481 4:131798947-131798969 CCAGCCCCTGCACTCCAGCCTGG - Intergenic
980912574 4:139006936-139006958 TCAGCTACTGCACTCCAGCCTGG - Intergenic
980939803 4:139263014-139263036 AGTGCCACTGCACTCTGGCCTGG + Intergenic
981096004 4:140782460-140782482 ATAGCCACTGCACTCTAGCCTGG + Intergenic
981122138 4:141064568-141064590 ACAGCCACTGCACTCCAGCCTGG + Intronic
981897751 4:149824432-149824454 ACTGCAACTGCACTATGGCCTGG - Intergenic
981931981 4:150199972-150199994 ATAGCCACTGCACTCTAGCCTGG + Intronic
982019898 4:151192230-151192252 ACAGATTCTGTACTCTTGCCGGG - Intronic
982118964 4:152120985-152121007 TCAGGTCCTGCAGTCTGCCCTGG + Intergenic
982254119 4:153435653-153435675 ATAGCCACTGCACTCTTGCCTGG - Intergenic
982522689 4:156439326-156439348 ACAGCCACTGCACTCCAGCCTGG - Intergenic
982819059 4:159923841-159923863 CCAGCCACTGCACTCTAGCCTGG + Intergenic
982930840 4:161405187-161405209 CATGCTACTGCACTCTGGCCTGG + Intronic
983901625 4:173141894-173141916 ACAGCCACTGCACTCCAGCCTGG + Intergenic
983922663 4:173363053-173363075 AGAGCCACTGCACTCTTGCCTGG + Intergenic
984200663 4:176716537-176716559 ACTGCACCTGCACTCCAGCCTGG + Intronic
984730225 4:183061263-183061285 ATAGCTACTGCACTCCAGCCTGG - Intergenic
984797952 4:183683110-183683132 ACAGCCACTGCACTCCAGCCTGG + Intronic
984890386 4:184486707-184486729 AACGCTACTGCACTCTAGCCTGG + Intergenic
985163419 4:187067764-187067786 CGAGCCACTGCACTCTGGCCTGG - Intergenic
985260784 4:188112855-188112877 ACAGCCACTGCACTCCAGCCTGG + Intergenic
985899467 5:2777424-2777446 CATGCTACTGCACTCTGGCCTGG - Intergenic
986227730 5:5832000-5832022 TCTGCCACTGCACTCTGGCCTGG + Intergenic
986548624 5:8927186-8927208 AGCGCCACTGCACTCTGGCCTGG + Intergenic
986567498 5:9129280-9129302 ACAGCAATTGCACTCTGGCAGGG + Intronic
987019050 5:13851349-13851371 CGAGCACCTGCACTCTGGCCTGG - Intronic
987112963 5:14703755-14703777 ATAGCCCATGCACTGTGGCCGGG + Intergenic
987317694 5:16739151-16739173 ATAGCCCCTGCACTCCAGCCTGG + Intronic
987361705 5:17113003-17113025 ACTGCTACTGCACTCCAGCCTGG + Intronic
987379422 5:17271181-17271203 TCAGCCACTGCACTATGGCCTGG - Intronic
987931738 5:24409119-24409141 CCTGCAACTGCACTCTGGCCTGG + Intergenic
988597123 5:32605483-32605505 ACAGCCACTGCACTCCAGCCTGG - Intergenic
988614611 5:32763354-32763376 ACTGCCACTGCACTCTAGCCTGG - Intronic
989736725 5:44716441-44716463 ATAGCTACTGCACTCTAGTCTGG + Intergenic
990263241 5:54048031-54048053 ATAGCTACTGCACTCTAGCCTGG - Intronic
990320896 5:54628729-54628751 CTAGCTCCTGGAGTCTGGCCTGG + Intergenic
991364813 5:65857754-65857776 AGTGCCACTGCACTCTGGCCAGG - Intronic
991439833 5:66635225-66635247 AGAGCTCTTTCACTCTGGCACGG - Intronic
991597668 5:68322118-68322140 ATAGCCACTGCACTCTAGCCTGG + Intergenic
991677768 5:69105740-69105762 TCACCTCCTGCTCTGTGGCCTGG - Intronic
991695679 5:69268791-69268813 TGAACTCCTGCACTCTAGCCTGG + Intronic
992209699 5:74465990-74466012 ATAGCTGATGCACTCTAGCCTGG + Intergenic
992272356 5:75077886-75077908 AGCGCCACTGCACTCTGGCCTGG + Intronic
992437346 5:76767744-76767766 CGTGCTACTGCACTCTGGCCTGG - Intergenic
992689283 5:79227490-79227512 ATAGCTGCTGCACTCCAGCCTGG + Intronic
993870774 5:93251813-93251835 ATAGCCACTGCACTCTAGCCTGG - Intergenic
994270747 5:97773173-97773195 ATAGCTACTGCACTCTCACCTGG - Intergenic
995564189 5:113416384-113416406 ATAGCCCCTGCACTCCAGCCTGG + Intronic
995709604 5:115021545-115021567 TCACCTCCTGCTATCTGGCCTGG + Intergenic
996102938 5:119463709-119463731 ACACCACTTGCACTCTAGCCTGG - Intronic
996565937 5:124880003-124880025 CGAGCCCCTGCACTCTAGCCTGG - Intergenic
996747272 5:126856291-126856313 AGCGCTACTGCAGTCTGGCCTGG - Intergenic
996869008 5:128164889-128164911 ACAGCTACTGCACTCCAACCTGG - Intronic
997020534 5:129995550-129995572 ACAGCCACTGCACTCCAGCCTGG - Intronic
997122975 5:131195223-131195245 ACAGCCACTGCACTCCAGCCTGG + Intronic
997123641 5:131202542-131202564 ATAGCTACTGCACTCCAGCCTGG - Exonic
997503722 5:134398990-134399012 ACAGCCACTGTACTCTAGCCTGG + Intergenic
997864592 5:137449841-137449863 ATAGCCACTGCACTCTGGCCTGG + Intronic
997908711 5:137846902-137846924 ACAGCTACTGCACTCCAGCCTGG + Intergenic
998026101 5:138818171-138818193 AATGCCACTGCACTCTGGCCTGG - Intronic
998049056 5:139016052-139016074 AGAGCCCCTGCACTCCAGCCTGG + Intronic
998998451 5:147893325-147893347 ACAGCCACTGCACTCCAGCCTGG - Intronic
999688118 5:154120862-154120884 ATAGCCACTGCACTCTAGCCTGG + Intronic
999731117 5:154477420-154477442 ACCGCTCCTGCACCCTTGGCTGG + Intronic
999897783 5:156053313-156053335 ACAGCTGCTGCCCTCTGTCCAGG - Intronic
1001507989 5:172295552-172295574 AGAGCCACTGCACTCTAGCCTGG + Intergenic
1001815556 5:174666293-174666315 TCAGCCCCTGCACTCCAGCCTGG + Intergenic
1001843018 5:174895600-174895622 TCACCTCCTGCTCTGTGGCCTGG + Intergenic
1002002122 5:176202199-176202221 TCTGCCACTGCACTCTGGCCTGG + Intergenic
1002100026 5:176853009-176853031 AGAGCTCCTTCACACAGGCCAGG + Intronic
1002301197 5:178258030-178258052 ACAGCCACTGCACTCCAGCCTGG + Intronic
1002321402 5:178378174-178378196 ACAGCCACTGCACTCTAGCCTGG + Intronic
1002381732 5:178834695-178834717 AGCGCTACTGCACTCTAGCCTGG - Intergenic
1002414551 5:179112835-179112857 AGAGCTCCTGCATTCTTCCCTGG - Exonic
1002659419 5:180781212-180781234 GCACCACCTGCACTCTAGCCTGG + Intergenic
1003007213 6:2393080-2393102 TCACCTCCTGCTCTGTGGCCTGG + Intergenic
1003140092 6:3464023-3464045 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1003342064 6:5231160-5231182 CCAGCTACTGCACTCCGGTCTGG + Intronic
1003665824 6:8110330-8110352 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1003729979 6:8810483-8810505 ACATCTCCTGCCTTCAGGCCAGG - Intergenic
1004127542 6:12888027-12888049 TGAGCTACTGCACTCTAGCCTGG + Intronic
1004139057 6:12998570-12998592 ATTGCCACTGCACTCTGGCCTGG + Intronic
1004561853 6:16760173-16760195 ACTGCTCGTTCACTCTGGGCCGG - Intronic
1004609392 6:17225043-17225065 ATAGCTGCTGCACTCCAGCCTGG - Intergenic
1004938971 6:20535973-20535995 CGAGCCACTGCACTCTGGCCTGG - Intronic
1004940940 6:20555664-20555686 AGCGCCACTGCACTCTGGCCTGG - Intronic
1005290146 6:24371560-24371582 ACTGCTACTGCACTCCGGCCTGG + Intergenic
1005388871 6:25313301-25313323 ACAGCGCCTGCAGCCTGCCCTGG + Intronic
1005465568 6:26109216-26109238 GCAGCTACTGCACTCCAGCCTGG + Intergenic
1005579604 6:27221137-27221159 GCAGCCCCTGCACTCCAGCCTGG + Intergenic
1005695945 6:28353004-28353026 ACTGCACCTGCACTCCAGCCTGG - Intronic
1005700712 6:28398078-28398100 GCTGCTCCTGCACCCAGGCCTGG + Exonic
1005757336 6:28936860-28936882 ACAGTCACTGCACTCTAGCCTGG - Intergenic
1005967263 6:30735590-30735612 ACTGCACCTGCACTCCAGCCTGG + Intronic
1006035323 6:31207055-31207077 TCAGCCACTGCACTCTAGCCTGG + Intergenic
1006069949 6:31490993-31491015 GCACATCCTGCACACTGGCCTGG + Intergenic
1006319377 6:33311276-33311298 ACTGCAACTGCACTCTAGCCTGG + Intronic
1006323511 6:33335574-33335596 CCTGCTACTGCACTCTAGCCTGG - Intergenic
1006356544 6:33562229-33562251 CCAGCCCCTGCACTCCAGCCTGG - Intergenic
1006767600 6:36522455-36522477 ACAGCCACTGCACTCCAGCCTGG + Intronic
1007400362 6:41599450-41599472 ACAGTTCCTCCACCCAGGCCAGG - Exonic
1007776795 6:44228500-44228522 CAGGCTCCTGCACTCTGGCCAGG + Intronic
1008787530 6:55187367-55187389 GAAGCCACTGCACTCTGGCCTGG + Intronic
1008889995 6:56476906-56476928 CCAGCTACTGCACTCCAGCCTGG + Intronic
1010544478 6:77133538-77133560 AAGGCTCCTCCACTCTGGCTGGG - Intergenic
1010751751 6:79623256-79623278 AGTGCCACTGCACTCTGGCCTGG + Intergenic
1010937564 6:81879813-81879835 CATGCTACTGCACTCTGGCCTGG + Intergenic
1011051134 6:83151194-83151216 ATAACCACTGCACTCTGGCCTGG - Intronic
1011113044 6:83859703-83859725 CCAGCTCCGGCTCTGTGGCCGGG - Exonic
1011617372 6:89209569-89209591 TCACCTCCTGCCCTCTCGCCTGG + Intronic
1011695291 6:89907087-89907109 ACTGCACCTGCACTCCAGCCTGG - Intergenic
1011949771 6:92951303-92951325 CCAGCTACTGCACTCCAGCCTGG + Intergenic
1012891545 6:104903091-104903113 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1013187588 6:107773871-107773893 ACAGTCCCTACACCCTGGCCTGG + Intronic
1013304814 6:108838363-108838385 ACACCTCCCTCACTCAGGCCTGG - Intergenic
1013521019 6:110933625-110933647 AGTGCCACTGCACTCTGGCCTGG + Intergenic
1014044766 6:116872768-116872790 GCAGCCACTGCACTCTAGCCTGG - Intergenic
1014444378 6:121510350-121510372 TGTGCTACTGCACTCTGGCCCGG - Intergenic
1015087620 6:129314353-129314375 AGCGCCACTGCACTCTGGCCTGG + Intronic
1015422765 6:133030113-133030135 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1015899027 6:138046003-138046025 ACACCTCCACCTCTCTGGCCTGG + Intergenic
1015902503 6:138082443-138082465 ACAGCTCCTACACACTCTCCAGG + Intergenic
1016029368 6:139322007-139322029 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1016201641 6:141417222-141417244 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1016392959 6:143593001-143593023 ACTGCACCTGCACTCCGGCCTGG + Intronic
1016412953 6:143802602-143802624 ACACCACCTGCACTCCAGCCTGG + Intronic
1016699437 6:147037710-147037732 ATAGCCTCTGCACTCTAGCCTGG + Intergenic
1017674736 6:156800849-156800871 TGAGCCACTGCACTCTGGCCTGG + Intronic
1017789959 6:157789148-157789170 AGCGCCACTGCACTCTGGCCTGG + Intronic
1017892672 6:158652289-158652311 GCAGCCACTGCACTCTAGCCTGG - Intronic
1018504521 6:164450564-164450586 TCAGCCATTGCACTCTGGCCTGG - Intergenic
1018621444 6:165732931-165732953 CCAGCACCTGGACTGTGGCCTGG + Intronic
1018693480 6:166369356-166369378 AGTGCTACTGCACTCTTGCCTGG + Intronic
1018811141 6:167299315-167299337 CCAACTCCTGCACTCTGCCGGGG + Intronic
1019049356 6:169171189-169171211 AGGGCTCCCGCATTCTGGCCTGG - Intergenic
1019258654 7:67545-67567 ACAGCTCTCGCTCTGTGGCCCGG + Intergenic
1019295319 7:270768-270790 GCCTCTCCTGCCCTCTGGCCTGG + Intergenic
1020034213 7:4954459-4954481 TGAGCTCCTGCACTCCAGCCTGG - Intronic
1020173238 7:5861930-5861952 ACAGCCACTGTACTCTAGCCTGG - Intergenic
1021480995 7:21116944-21116966 AGAGCCACTGCACTCTAGCCTGG - Intergenic
1021507023 7:21397156-21397178 AGAGCTACTGCACTCCAGCCTGG - Intergenic
1021550847 7:21869564-21869586 ACAGCTCCTGGGCAGTGGCCTGG - Intronic
1021886935 7:25148403-25148425 ACAGCCACTGCACTCCAGCCTGG + Intronic
1022123281 7:27331127-27331149 CGAGCCACTGCACTCTGGCCTGG - Intergenic
1022235324 7:28455238-28455260 ACAGCTCCTGCAGTTCGGCTCGG - Intronic
1022729573 7:33009718-33009740 AGTGCTGCTGCACTCTAGCCTGG + Intergenic
1022734226 7:33061429-33061451 ATAGCTACTGCACTCCAGCCTGG - Intronic
1022921418 7:35019407-35019429 ACAGCCACTGCTCTCTAGCCTGG + Intronic
1023252802 7:38283704-38283726 TCAGCCACTGCACTCTAGCCTGG + Intergenic
1023561076 7:41473887-41473909 AGAGCTGCTGCACTCCAGCCTGG + Intergenic
1023600943 7:41881126-41881148 AGAGCCACTGCACTCTAGCCTGG + Intergenic
1023810750 7:43909674-43909696 GCAGCCACTGCACTCTAGCCTGG + Intronic
1024271203 7:47643264-47643286 AGCGCCCCTGCACTCTAGCCTGG - Intergenic
1024276581 7:47682206-47682228 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1024278190 7:47696177-47696199 ACTGCCACTGCACTCTAGCCTGG + Intronic
1024421595 7:49173561-49173583 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1025166247 7:56714915-56714937 AGCGCTACTGCACTCTGGCTTGG - Intergenic
1025168772 7:56737061-56737083 GCAGCTGCTGCACTCCAGCCTGG + Intergenic
1025703618 7:63842851-63842873 GCAGCTGCTGCACTCCAGCCTGG - Intergenic
1026465389 7:70649354-70649376 CATGCCCCTGCACTCTGGCCTGG + Intronic
1026670309 7:72384598-72384620 TCAGCTACTGCACTCCAGCCTGG + Intronic
1026690704 7:72547840-72547862 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1026707034 7:72703066-72703088 AGTGCCACTGCACTCTGGCCTGG - Intronic
1026810980 7:73464767-73464789 CATGCCCCTGCACTCTGGCCTGG - Intronic
1026812715 7:73481993-73482015 CCCGCCACTGCACTCTGGCCTGG + Intronic
1026816716 7:73518668-73518690 ACAGCTGCTGCACTCCAGCCTGG + Intronic
1027220464 7:76210711-76210733 ATAGCCCCTGCACTCCAGCCTGG + Intronic
1027259415 7:76453968-76453990 CCAGCTACTGCACTCTAGCCAGG + Intergenic
1027262911 7:76477755-76477777 GCAGCCACTGCACTCTAGCCTGG + Intronic
1027283060 7:76622913-76622935 CCAGCTACTGCACTCTCGCCAGG - Intronic
1027310786 7:76952049-76952071 CCAGCTACTGCACTCTAGCCAGG + Intergenic
1028525586 7:91782024-91782046 ATAGCTGCTGCACTCCAGCCTGG - Intronic
1028530587 7:91833695-91833717 ATAGCCACTGCACTCTAGCCTGG + Intronic
1028549986 7:92049565-92049587 CCAGCTACTGCACTCCAGCCTGG + Intronic
1029285756 7:99464919-99464941 TCAGCTACTGCACTCTAGCCTGG + Intronic
1029296140 7:99542097-99542119 CAAGCCCCTGCACTCTAGCCTGG - Intergenic
1029356689 7:100057309-100057331 AATGCTCCTGCACCCAGGCCTGG - Exonic
1029816096 7:103096619-103096641 ACAGCCACTGCACTCCAGCCTGG - Intronic
1029913763 7:104184413-104184435 ACAGCCACTGCACTCCAGCCTGG + Intronic
1029917415 7:104225506-104225528 ACAGCTGCTGCACTTAAGCCTGG - Intergenic
1030063085 7:105638738-105638760 ACAGCTCCTGTTCTGTGGCTAGG + Intronic
1030127687 7:106169842-106169864 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1030488338 7:110199830-110199852 AAAGTTCCTGCACAGTGGCCAGG - Intergenic
1030506759 7:110434399-110434421 TGAGCTACTGCACTCTAGCCTGG - Intergenic
1030658168 7:112191121-112191143 CTAGCTACTGCACTCTAGCCTGG - Intronic
1030734121 7:113024576-113024598 ACTGCCTCTGCACTCTGGCCTGG - Intergenic
1030878473 7:114846040-114846062 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1031621396 7:123938133-123938155 ACAGCCACTGTACTCTAGCCTGG - Intronic
1031895945 7:127347883-127347905 AGAGCTCCAGCACGCTGCCCGGG - Intronic
1032030054 7:128475692-128475714 CCAGCTACTGCACTCCAGCCTGG + Intergenic
1032124016 7:129178389-129178411 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1032630060 7:133640909-133640931 ACAGCCACTGCACTCCAGCCTGG - Intronic
1032829662 7:135610038-135610060 ACAAATCCTGCACTCTGGCATGG - Intronic
1033069965 7:138192967-138192989 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1033093985 7:138413665-138413687 TGCGCTACTGCACTCTGGCCTGG + Intergenic
1033138871 7:138807625-138807647 ATAGCCACTGCACTCTAGCCTGG + Intronic
1033357675 7:140613552-140613574 AAAGCTACTGCACTCTAGCCTGG + Intronic
1033362276 7:140646080-140646102 ATAGCCACTGCACTCTAGCCTGG + Intronic
1033393548 7:140951511-140951533 ACCGCTGCTGTACTCTAGCCTGG + Intergenic
1034280546 7:149850894-149850916 AAGGCTCCTGCATCCTGGCCAGG + Intronic
1034286510 7:149886914-149886936 TGTGCTCCTGCATTCTGGCCTGG + Intergenic
1034340590 7:150351821-150351843 ATAGCTGCTGCACTCTAGTCTGG + Intergenic
1034458957 7:151187527-151187549 ACAGCTCCTGCAACCTTGCCAGG + Intronic
1034536278 7:151727781-151727803 ACAGCACCTGAACGCTGACCCGG - Intronic
1035188942 7:157148780-157148802 ATAGCTACTGCACTCCAGCCTGG - Intronic
1035201568 7:157270858-157270880 AGTACTACTGCACTCTGGCCAGG - Intergenic
1035426475 7:158779346-158779368 ACAGTCACTGCACTCTAGCCTGG + Intronic
1035983326 8:4397576-4397598 TCAGGTGCTGCACTGTGGCCTGG - Intronic
1036164052 8:6415329-6415351 CCAGCTACTGCACTCTAGCTTGG - Intronic
1036542777 8:9734996-9735018 AGAGCTTCTGCACTCTTGCCAGG - Exonic
1037222677 8:16544247-16544269 AGCGCCACTGCACTCTGGCCTGG + Intronic
1037298264 8:17424000-17424022 ACTGCTACTGCACTCCAGCCTGG + Intergenic
1037303901 8:17484809-17484831 AGAGCTACTGCACTCCAGCCTGG - Intergenic
1037619510 8:20551121-20551143 ACAGCCCCTGCATTCCAGCCTGG - Intergenic
1037795043 8:21986179-21986201 AGCGCCACTGCACTCTGGCCTGG - Intronic
1038185121 8:25266257-25266279 AGTGCCACTGCACTCTGGCCTGG - Intronic
1038645512 8:29358473-29358495 AGAGCCACTGCACTCTAGCCTGG - Intergenic
1038776491 8:30535939-30535961 ACAGCTGCTGCACTCCAGCCTGG + Intronic
1039015244 8:33140966-33140988 GTAGCTACTGCACTCTAGCCTGG - Intergenic
1039412341 8:37365512-37365534 ACAGCTCCTGCTCTAGGCCCTGG - Intergenic
1039475388 8:37836884-37836906 TCAGGTCTTGCATTCTGGCCAGG + Intronic
1039485829 8:37908991-37909013 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1039540482 8:38363594-38363616 ATTGCACCTGCACTCTAGCCTGG + Intronic
1039550588 8:38440321-38440343 GATGCTTCTGCACTCTGGCCGGG - Intronic
1040045203 8:42955905-42955927 ATAGCCACTGCACTCTAGCCTGG - Intronic
1040443816 8:47473046-47473068 CCAGCCCCTGCACTCTCTCCAGG + Intronic
1040767992 8:50938932-50938954 AGAGCCACTGCACTCTAGCCTGG - Intergenic
1040937560 8:52796947-52796969 ACAGCTCCTGCTCTGCAGCCAGG + Intergenic
1041071431 8:54129282-54129304 CCTGCCACTGCACTCTGGCCTGG + Intergenic
1041261218 8:56022043-56022065 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1041281599 8:56215642-56215664 TCATCTCCTGCTATCTGGCCGGG + Intronic
1041493865 8:58464863-58464885 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1042131731 8:65593988-65594010 ACACCACCTGCACTCCAGCCTGG + Intergenic
1042263775 8:66887504-66887526 ACTGCCACTGCACTCTGGCCTGG + Intronic
1042566442 8:70116896-70116918 ACAGCCACTGCACTCCAGCCTGG - Intronic
1042567889 8:70131224-70131246 AAAGCTACTGCACTCTAGCCTGG - Intronic
1042568120 8:70133248-70133270 AAAGCTACTGCACTCCAGCCTGG - Intronic
1042878861 8:73465851-73465873 ACTGCACCTGCACTCCAGCCTGG - Intronic
1042918823 8:73901709-73901731 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1042942926 8:74125908-74125930 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1043345557 8:79294199-79294221 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1043384421 8:79733761-79733783 ACAGTCACTGCACTCTAGCCTGG + Intergenic
1043878817 8:85517875-85517897 CCTGCCACTGCACTCTGGCCTGG - Intergenic
1045307132 8:100967890-100967912 ATAGCCACTGCACTCTAGCCTGG + Intergenic
1045501083 8:102745011-102745033 AGAGCTCCTGAATCCTGGCCAGG + Intergenic
1045759085 8:105582635-105582657 TGCGCTGCTGCACTCTGGCCTGG - Intronic
1045848892 8:106670125-106670147 ACAGGCCTTGCACTCTGGCCCGG - Intronic
1046208016 8:111028883-111028905 ACAGCCACTGTACTCTAGCCTGG - Intergenic
1047239966 8:123078008-123078030 ACTGCCACTGCACTCTAGCCTGG + Intronic
1047858095 8:128934818-128934840 TAAGCTGCTGCACTCTAGCCTGG + Intergenic
1048031670 8:130639104-130639126 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1048087162 8:131196119-131196141 CAGGCTGCTGCACTCTGGCCTGG - Intergenic
1048310278 8:133316996-133317018 ACAGCAACTGCACTCCAGCCTGG - Intergenic
1048364162 8:133723874-133723896 CAAGCCACTGCACTCTGGCCTGG - Intergenic
1048786135 8:138052499-138052521 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1049130113 8:140832096-140832118 TTGGCTACTGCACTCTGGCCTGG - Intronic
1049531640 8:143158298-143158320 ACAGCCCCTGGGCCCTGGCCGGG - Exonic
1049585140 8:143429479-143429501 ACAGGTCCCGCTCTTTGGCCAGG + Exonic
1049643660 8:143726686-143726708 ACTGCTCCTGCGCTCCGGCACGG + Exonic
1049649523 8:143758902-143758924 CCAGCTGCAGCACTCAGGCCAGG - Intergenic
1049660549 8:143817902-143817924 TCAAGTCCTGCACACTGGCCCGG - Exonic
1049734005 8:144193964-144193986 ACAGCTCCTGCATGCTGGATAGG - Intronic
1049738653 8:144223406-144223428 ACAGCCACTGCACTCCAGCCTGG - Intronic
1049980631 9:901056-901078 CATGCTGCTGCACTCTGGCCTGG - Intronic
1050302723 9:4275717-4275739 CGTGCTACTGCACTCTGGCCTGG + Intronic
1050534064 9:6615964-6615986 ACAGCCACTGCACTCCAGCCTGG - Intronic
1050554195 9:6775052-6775074 ACTGCACTTGCACTCTGACCTGG - Intronic
1050720327 9:8581701-8581723 CCCGCTACTGCACTCTAGCCCGG + Intronic
1051158878 9:14183445-14183467 AGTGCTACTGCACTCTAGCCTGG - Intronic
1051533393 9:18130265-18130287 GCAGCTCCTGCTTTCTGGCCTGG + Intergenic
1052362345 9:27574171-27574193 ACAGCTCCGGCACTGCGGGCGGG + Intergenic
1052825072 9:33168070-33168092 TGATCTCCTGCACGCTGGCCTGG - Intergenic
1052930768 9:34053687-34053709 ATAGGTACTGCACTCTGGCCTGG - Intergenic
1052979957 9:34440900-34440922 ATAGCCACTGCACTCTAGCCTGG - Intronic
1053091533 9:35282472-35282494 ACAGCCACTGCACTCCAGCCTGG - Intronic
1053091890 9:35286273-35286295 ACAGCCACTGCACTCCAGCCTGG - Intronic
1053111402 9:35463142-35463164 ACAGCCACTGCACTCTACCCTGG + Intergenic
1053213458 9:36251454-36251476 ATAGCTACTGCACTCTAGCTTGG - Intronic
1053366090 9:37523507-37523529 CGAGCCACTGCACTCTGGCCTGG + Intronic
1053551504 9:39084240-39084262 AGAGATCCTGCACTCCAGCCTGG - Intronic
1053605882 9:39658333-39658355 ACACCTCCTGCAGGGTGGCCAGG + Intergenic
1053721643 9:40952299-40952321 ACAGCCCCTGCACTCCGGCCTGG + Intergenic
1053788986 9:41672756-41672778 GCAGCTACTGCAGTGTGGCCTGG - Intergenic
1053815624 9:41904366-41904388 AGAGATCCTGCACTCCAGCCTGG - Intronic
1053863799 9:42414957-42414979 ACACCTCCTGCAGGGTGGCCAGG + Intergenic
1054177268 9:61884101-61884123 GCAGCTACTGCAGTGTGGCCTGG - Intergenic
1054247663 9:62684083-62684105 ACAACTCCTGCAGGGTGGCCAGG - Intergenic
1054344319 9:63899694-63899716 ACAGCCCCTGCACTCCAGCCTGG - Intergenic
1054475924 9:65573012-65573034 GCAGCTACTGCAGTGTGGCCTGG + Intergenic
1054561779 9:66718608-66718630 ACACCTCCTGCAGGGTGGCCAGG - Intergenic
1054614972 9:67283075-67283097 AGAGATCCTGCACTCCAGCCTGG + Intergenic
1054660265 9:67696704-67696726 GCAGCTACTGCAGTGTGGCCTGG + Intergenic
1054817234 9:69486820-69486842 TCAGCTCCTACTCTCTGCCCCGG + Intronic
1054908908 9:70435885-70435907 ACAGCCACTGCACTCTAGCCTGG + Intergenic
1055106627 9:72519839-72519861 AGTGCTACTGCATTCTGGCCTGG + Intergenic
1055123023 9:72685148-72685170 AGCGCCACTGCACTCTGGCCTGG - Intronic
1055171228 9:73260405-73260427 AGAGCCACTGCACTCTAGCCTGG + Intergenic
1055447906 9:76401296-76401318 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1055493788 9:76833923-76833945 GCAGCCACTGCACTCCGGCCTGG - Intronic
1055950624 9:81726430-81726452 ACAGCCACTGCACTCCAGCCTGG - Intergenic
1056211828 9:84372007-84372029 CCAGCTCCTCCACCCTGACCAGG - Intergenic
1056448161 9:86686656-86686678 TGAGCTCCTGCACTCCAGCCTGG + Intergenic
1056664471 9:88570784-88570806 CCCGCCACTGCACTCTGGCCTGG - Intronic
1057208753 9:93188180-93188202 GCAGCACCTGCAGTCTGTCCAGG + Intronic
1057375992 9:94523591-94523613 CCAGCTACTGCACTCCAGCCTGG + Intergenic
1057782406 9:98060625-98060647 ACACCTTCTGCACTCCAGCCTGG + Intronic
1057903761 9:98968759-98968781 TCAGCTCCTGCAGTTGGGCCTGG + Intronic
1058052832 9:100423700-100423722 TCATAACCTGCACTCTGGCCTGG + Intergenic
1058234700 9:102475166-102475188 AGAGCTACTGCACTCCAGCCTGG + Intergenic
1058724015 9:107784910-107784932 CCAGCTCCTGCAGCCTGACCTGG - Intergenic
1058877591 9:109257950-109257972 AGTGCCACTGCACTCTGGCCTGG + Intronic
1059020453 9:110570999-110571021 ACAGGTCTTGCACTGTCGCCTGG + Intronic
1059476301 9:114550665-114550687 ATAGCCACTGCACTCTAGCCTGG - Intergenic
1059647837 9:116285211-116285233 AGTGCCACTGCACTCTGGCCTGG - Intronic
1060068447 9:120525659-120525681 TCAGCCACTGCACTCTAGCCTGG - Intronic
1060140291 9:121203389-121203411 ACAGCCACTGCACTCCAGCCTGG + Intronic
1060244840 9:121936305-121936327 CGAGCCACTGCACTCTGGCCTGG - Intronic
1060392016 9:123285545-123285567 CCAGCCACTGCACTCTAGCCTGG - Intergenic
1060474332 9:123975593-123975615 AGTGCTCCTGCACTCCAGCCTGG + Intergenic
1060675736 9:125512926-125512948 ACAGCCACTGCACTCCAGCCTGG - Intronic
1060862805 9:126969270-126969292 ATAGCCACTGCACTCTAGCCTGG - Intronic
1060950724 9:127600674-127600696 ATAGCTACTGCACTCCAGCCTGG - Intergenic
1061376241 9:130226442-130226464 ACAGCGCCTGCACAATGGACGGG - Exonic
1061607929 9:131725500-131725522 AGCGCTGCTGCGCTCTGGCCTGG - Intronic
1061610719 9:131743874-131743896 ATAGCTACTGCACTCCAGCCTGG + Intergenic
1061688800 9:132307208-132307230 TCAGCTACTGCACTCCAGCCTGG + Intronic
1061895495 9:133644749-133644771 CCCGTCCCTGCACTCTGGCCAGG - Intronic
1062400499 9:136370536-136370558 CCAGCTCCTGCACCCGGGCCTGG + Exonic
1203734926 Un_GL000216v2:127914-127936 ACAGCCCCTGCACTATAGCCTGG - Intergenic
1203453510 Un_GL000219v1:143697-143719 ACATCCCCTGCACTCGGGCCTGG - Intergenic
1185632830 X:1528022-1528044 ACTACTCCTGCACTCAGGACAGG - Intronic
1185667092 X:1774508-1774530 CCACCTCCTGCTCTGTGGCCCGG + Intergenic
1186169624 X:6863081-6863103 AATGCCACTGCACTCTGGCCAGG - Intergenic
1186461024 X:9748733-9748755 CCAGCTCCTGCGCTCTGGAAAGG + Intronic
1186886298 X:13917167-13917189 ACTGCTACTGCACTCCAGCCTGG + Intronic
1187134957 X:16539161-16539183 ATAGCTGCTGCACTCCAGCCTGG - Intergenic
1187395587 X:18916388-18916410 CGAGCCACTGCACTCTGGCCTGG + Intronic
1187578608 X:20584617-20584639 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1187611729 X:20950862-20950884 AGTGCTACTGCACTCTAGCCTGG + Intergenic
1187899388 X:24013139-24013161 ATAGCTACTGCACTCCAGCCTGG - Intronic
1188241172 X:27792500-27792522 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1188289358 X:28368705-28368727 ATAGCTTCTGCACTCCAGCCTGG + Intergenic
1188446345 X:30256751-30256773 TCAGCTCTGGCACTCTGGCAAGG - Intergenic
1188873751 X:35405156-35405178 ACGGCTGCTGCACTCCAGCCTGG - Intergenic
1189240139 X:39518582-39518604 ACAGCCCCAGCACTCGGGCAAGG + Intergenic
1189307793 X:40000191-40000213 GCAGCCACTGCACTCTGGCCTGG + Intergenic
1189371526 X:40433055-40433077 ATAGCTACTGCACTCTAGCCTGG + Intergenic
1189426566 X:40907014-40907036 AAAGCTCCTGCACTCCAGCCCGG + Intergenic
1189494437 X:41496392-41496414 CCAGCCACTGCACTCTAGCCTGG - Intergenic
1189823738 X:44896115-44896137 CCAGCCACTGCACTCTAGCCTGG - Intronic
1190178827 X:48174267-48174289 CACGCCCCTGCACTCTGGCCTGG - Intergenic
1190295264 X:49022971-49022993 ATAGCCCCTGAACTCTAGCCTGG - Intergenic
1190334843 X:49256016-49256038 TTATCTCCAGCACTCTGGCCAGG - Intronic
1190758091 X:53418476-53418498 ACTGCTACTGCACTCCAGCCTGG - Intronic
1190778062 X:53570155-53570177 ATAGCCACTGTACTCTGGCCTGG - Intronic
1190860247 X:54338019-54338041 AGAGCCACTGCACTCTAGCCTGG + Intronic
1191878339 X:65819438-65819460 ACAGCCACTGCACTCCAGCCTGG + Intergenic
1192126630 X:68506781-68506803 ACAGCCACTGCACTCCAGCCTGG - Intronic
1192301560 X:69909338-69909360 CAAGCTCCTACACTCTAGCCTGG - Intronic
1192485049 X:71517828-71517850 ACAGCCACTGCACTCCAGCCTGG - Intronic
1192492582 X:71589318-71589340 ATAGCCACTGTACTCTGGCCTGG - Intronic
1193129079 X:77900319-77900341 ACTGCTACTGCACTCCAGCCTGG + Intronic
1195130996 X:101851886-101851908 AGCGCCACTGCACTCTGGCCTGG + Intronic
1196083431 X:111658604-111658626 ATAGCCACTGCACTTTGGCCTGG + Intergenic
1196785019 X:119414436-119414458 ACTGCTACTGCACTCCAGCCTGG - Intronic
1196794475 X:119491104-119491126 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1197190525 X:123642476-123642498 ACAGTTCCTGCTCTCAAGCCTGG + Intronic
1197201774 X:123754643-123754665 ACTGCCACTGCACTCTAGCCTGG - Intergenic
1197221757 X:123921293-123921315 TCAGCCACTGCACTCTAGCCTGG - Intergenic
1197831347 X:130646394-130646416 CCAGCTTCAGCACTCAGGCCAGG + Intronic
1198090458 X:133323435-133323457 CCTGCCACTGCACTCTGGCCTGG + Intronic
1198845832 X:140909363-140909385 ACACCTTTTGCACTATGGCCTGG - Intergenic
1199100966 X:143799642-143799664 AGCGCCACTGCACTCTGGCCTGG - Intergenic
1200806942 Y:7443151-7443173 AGCGCCACTGCACTCTGGCCTGG + Intergenic
1201292720 Y:12437465-12437487 CCAGCCACTGCACTCTAGCCTGG + Intergenic
1201786741 Y:17791629-17791651 TCCGCTCCTGCACTCCTGCCTGG + Intergenic
1201814812 Y:18114359-18114381 TCCGCTCCTGCACTCCTGCCTGG - Intergenic
1201984521 Y:19951256-19951278 CGTGCCCCTGCACTCTGGCCTGG + Intergenic
1202047295 Y:20747795-20747817 TGAGCTCCTGCACTCTGGATAGG + Intergenic
1202297366 Y:23374233-23374255 GCACCTACTGCATTCTGGCCTGG - Intergenic
1202573441 Y:26296364-26296386 GCACCTACTGCATTCTGGCCTGG + Intergenic
1202626980 Y:56869829-56869851 ACCACTACTGCACTCTAGCCTGG + Intergenic