ID: 1178849354

View in Genome Browser
Species Human (GRCh38)
Location 21:36200344-36200366
Sequence ACCGCCGCGTGTGCCAGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178849354_1178849358 -9 Left 1178849354 21:36200344-36200366 CCTCTCCTGGCACACGCGGCGGT 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1178849358 21:36200358-36200380 CGCGGCGGTGTCGGTGAGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178849354 Original CRISPR ACCGCCGCGTGTGCCAGGAG AGG (reversed) Exonic
900462805 1:2809534-2809556 ACCTCCCCCTGTGCCAGGAGTGG - Intergenic
900468470 1:2837750-2837772 AGAGCCAAGTGTGCCAGGAGTGG - Intergenic
901001041 1:6148962-6148984 TCTGCCGCGTGTGCAAGGACGGG - Exonic
903232339 1:21929561-21929583 ACCGGCAGGTGGGCCAGGAGTGG - Intronic
906116337 1:43359514-43359536 ACCGCCAGGTTTGCTAGGAGTGG - Exonic
907051049 1:51330268-51330290 GCCGCCGCCGCTGCCAGGAGTGG - Intronic
922574364 1:226652315-226652337 AAAGCGGCGTGTGCCTGGAGTGG - Intronic
1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG + Intronic
1080896611 11:36453593-36453615 ACCTCCCAGTGTGCCAGGACAGG - Intronic
1083171875 11:60927941-60927963 ACCCCCGCGCTTCCCAGGAGTGG - Intronic
1083591578 11:63898426-63898448 ACAGCCCAGTGTGCCAGAAGGGG - Intronic
1083675743 11:64323736-64323758 ACCCCCGAGTTTGGCAGGAGAGG - Intergenic
1083749621 11:64754020-64754042 CCCACCCCGTGTGCCAGGCGTGG - Exonic
1084530582 11:69725507-69725529 ACCACCGTGTGGGCCAGGTGTGG + Intergenic
1088279393 11:108121409-108121431 ACCGCAGCCTGGGCCAGGAAAGG - Intergenic
1113018579 13:105856612-105856634 ACCCCGGCCTGTGCCAGGCGTGG - Intergenic
1113707254 13:112442892-112442914 ACCTCCACGTGTGCCCGGGGCGG + Intergenic
1122897690 14:104768651-104768673 ACCGCGCCCTGAGCCAGGAGAGG - Intergenic
1126671720 15:51121367-51121389 ACCTCAGCTTGAGCCAGGAGAGG - Intergenic
1132639300 16:970500-970522 ACGGCCGCGCCTGCCAGGACCGG - Intronic
1132767118 16:1540000-1540022 TCCGCCCCGAGTGACAGGAGGGG + Intronic
1141829010 16:86499062-86499084 ACCCCCGCGGGTTCCAGGGGCGG - Intergenic
1142864204 17:2780401-2780423 ACCGCCCCGTTTGACAGGGGAGG + Intronic
1146797937 17:35795700-35795722 ACCGCCTCGCGTTCCAGCAGCGG - Intronic
1148565102 17:48627846-48627868 ACCTCCCCAAGTGCCAGGAGAGG - Intronic
1148652531 17:49260305-49260327 GCAGCCGCGTGGGCCGGGAGGGG - Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1151359753 17:73581793-73581815 AGCCCCGAGTGGGCCAGGAGTGG + Intronic
1152236132 17:79139830-79139852 ACCACCGTGTGTGCCCGGGGAGG + Intronic
1152550474 17:81027569-81027591 ACGGCCCCCAGTGCCAGGAGGGG + Intergenic
1153383710 18:4468644-4468666 ACCCCCTCGTTTCCCAGGAGTGG - Intergenic
1160266206 18:77342302-77342324 TCCGCTGCGTGTCCCTGGAGAGG - Intergenic
1163250761 19:16125148-16125170 ACCACCCCGTGGGCCATGAGGGG + Intronic
1163263169 19:16203558-16203580 ACCCCCCCGTGGGCCAGGATGGG - Exonic
1165937421 19:39397807-39397829 ACCGCAGCGGGAGCCAGCAGGGG + Exonic
1166293808 19:41879275-41879297 ACCTCCGCGTGCGCCGTGAGTGG + Exonic
927055670 2:19363577-19363599 ACCTCCGGGTGTGCCGGGAGGGG - Intergenic
940985923 2:160052278-160052300 ACCAACCCCTGTGCCAGGAGGGG + Intronic
942438095 2:176002600-176002622 ACCGCCGCGCGAGCGAAGAGTGG + Intronic
1172118764 20:32585626-32585648 ACCGCCGCGTCCGGGAGGAGCGG - Intronic
1173726335 20:45300921-45300943 ACCGCTGCCTGTGCCCCGAGGGG - Exonic
1174812646 20:53660214-53660236 TGCCCCGCGTGTGCAAGGAGCGG + Intergenic
1178453783 21:32728218-32728240 ACCGCCGGGGGTGCAGGGAGAGG + Intergenic
1178849354 21:36200344-36200366 ACCGCCGCGTGTGCCAGGAGAGG - Exonic
1181107796 22:20585058-20585080 TGGGCCGCGTGTGCCAGGTGTGG + Intronic
1184599373 22:45533454-45533476 ACAGACGCGGGGGCCAGGAGAGG - Intronic
950080847 3:10221040-10221062 ACGGGTGTGTGTGCCAGGAGTGG - Intronic
953131569 3:40144369-40144391 ACCACCACTAGTGCCAGGAGTGG + Intronic
981429654 4:144645355-144645377 ACAGACGCGTGTGCGCGGAGTGG - Intergenic
987193280 5:15500475-15500497 GCCACCGGGGGTGCCAGGAGGGG + Exonic
998200217 5:140113288-140113310 ACTGCCGTGTGTGCGGGGAGGGG + Intronic
998859371 5:146427693-146427715 AACGCCAGCTGTGCCAGGAGAGG + Intergenic
999868773 5:155728887-155728909 TTCGCCGCGTGGCCCAGGAGAGG + Intergenic
1005611516 6:27529961-27529983 ACCGCCCCGTCTGGCAGGTGGGG - Intergenic
1013709418 6:112879932-112879954 ATCCCAGCGGGTGCCAGGAGAGG + Intergenic
1017940516 6:159048880-159048902 CCCGCGGTGTGTGCAAGGAGAGG - Intergenic
1035403934 7:158586812-158586834 TCCGCCGCGTGTGCCGCGAGGGG - Intronic
1051449271 9:17177863-17177885 ACCGCTGCCTGAGCCAGCAGTGG - Intronic
1056481574 9:87011860-87011882 ACCGCCAGGTTTGCTAGGAGTGG - Intergenic
1061838952 9:133346856-133346878 ACCGCAGGGGGTGCCAGGACTGG + Intronic
1061907249 9:133704996-133705018 AAGGCTGCGTGTTCCAGGAGCGG - Exonic
1062313012 9:135949632-135949654 ACTTCCTCGGGTGCCAGGAGGGG - Intronic
1189915559 X:45851775-45851797 GCCGCCGCGGGCCCCAGGAGTGG - Intergenic
1190216463 X:48482332-48482354 ACCGCCGCCTGTGTCATGACTGG + Intronic