ID: 1178850008

View in Genome Browser
Species Human (GRCh38)
Location 21:36205223-36205245
Sequence CACTCACCTGCTCTCAGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178850000_1178850008 21 Left 1178850000 21:36205179-36205201 CCAAAGTTGTGGAGTGCTTGGGA 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1178850008 21:36205223-36205245 CACTCACCTGCTCTCAGTTGTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178850008 Original CRISPR CACTCACCTGCTCTCAGTTG TGG Intronic
900784280 1:4637980-4638002 CACTGACCTGCTCCAAGGTGAGG - Intergenic
903260050 1:22126700-22126722 CACTCACATGCTCTCAGGACTGG - Intronic
905772846 1:40649541-40649563 CACACACCTGCTCAGAGGTGGGG - Intronic
906204789 1:43981016-43981038 CACTCAGCTGCTCACACTCGTGG - Intronic
906648534 1:47493443-47493465 CACTCAGGTGGTCTTAGTTGGGG - Intergenic
908357312 1:63335489-63335511 CACTCTCCTGCCCTCAGTGGAGG - Intergenic
908720625 1:67121834-67121856 CAACCTCCTACTCTCAGTTGAGG + Intronic
908856919 1:68440846-68440868 AACTCACCTGCTTGCAGTGGTGG + Exonic
910721580 1:90292630-90292652 CACTCTCTTTCTCTCAGATGAGG + Intergenic
910986921 1:93014192-93014214 CAGTCAGCAGCTCTCAGCTGGGG - Intergenic
911160616 1:94679418-94679440 CACTAACCTGTTCTGAGTTTTGG + Intergenic
911921996 1:103776038-103776060 CTCTCCCCCGCTCTCTGTTGTGG - Intergenic
915222356 1:154385155-154385177 TACTCATCTGCTCTCAGGAGAGG - Intergenic
915701487 1:157801247-157801269 CCCTCATGTGCTATCAGTTGAGG - Intronic
917523612 1:175768182-175768204 CACTCACCTGCCCTCTGTACCGG - Intergenic
918340660 1:183565697-183565719 CACTCACCTGGTGACAGCTGGGG + Exonic
920686144 1:208110338-208110360 CCCTCACCTGCTCCCAGCAGGGG - Intronic
921202929 1:212824313-212824335 CATTCACCTGCTCACAGGAGAGG + Intergenic
924941286 1:248813781-248813803 CCCTCACCTGCTCCCTGTTCAGG + Intronic
1063868813 10:10396459-10396481 AATTCAAATGCTCTCAGTTGTGG + Intergenic
1069857094 10:71447402-71447424 CTCTCCCCTGCTGTCAGTGGGGG + Intronic
1071905945 10:90173733-90173755 CACTCACCCCCTCCCAGATGAGG - Intergenic
1072743377 10:97923570-97923592 CACTCACATGTTTCCAGTTGAGG + Intronic
1074137776 10:110643425-110643447 CACTCACCGGTTCACAGCTGTGG - Intergenic
1074534766 10:114320804-114320826 CACTTCCCTGCTCCCAGGTGTGG - Intronic
1074871006 10:117576047-117576069 AACTCAGATGTTCTCAGTTGAGG - Intergenic
1074877172 10:117622486-117622508 CAGGCAGCTGCTCTCAGGTGAGG - Intergenic
1076443150 10:130493991-130494013 CTCTCCCCTGCTATCCGTTGAGG - Intergenic
1077517721 11:3011946-3011968 CACTCAGCTGCACTCACTCGAGG + Intronic
1078577041 11:12511379-12511401 CACCCACCTGCCCTTGGTTGAGG - Intronic
1083623366 11:64059711-64059733 CACTCAGCTACTCCCAGCTGAGG + Intronic
1088736688 11:112733438-112733460 CACTCAGCTGTAGTCAGTTGAGG + Intergenic
1090605750 11:128421658-128421680 CTCTCCCCTGCTTACAGTTGTGG + Intergenic
1096109848 12:49022036-49022058 CTCTCACCTCCTCTCCTTTGGGG + Exonic
1099844611 12:88013897-88013919 CACCCACAGGCTCTCAGTTCTGG - Intronic
1100326371 12:93543506-93543528 CCCTCTCCTGCTCTCAGAGGTGG - Intergenic
1102024789 12:109708291-109708313 CAAACACCTGCTCTGTGTTGAGG - Intergenic
1103074952 12:117974561-117974583 CCTTCACCTGCTCTCCGTTGAGG - Intergenic
1103883543 12:124184600-124184622 GACACACATGCTCTCAGCTGAGG + Intronic
1104724850 12:131069573-131069595 CACACACATGATCTCAGTGGAGG + Intronic
1104802460 12:131563911-131563933 CACACACATGATCTCAGTGGAGG - Intergenic
1111658622 13:91181514-91181536 CATTCACATGATCTCAGTAGTGG + Intergenic
1113649720 13:112027013-112027035 CCTTCCCCTGCTCTCAGATGTGG - Intergenic
1113761698 13:112852578-112852600 CACTCACCTGCTGTCTGTCCAGG + Intronic
1113941207 13:114019433-114019455 CCCTCTTCTGCTCTCATTTGTGG + Intronic
1113945827 13:114043624-114043646 CTCTCGCCTGCCCTCAGTGGTGG - Intronic
1116793572 14:49365684-49365706 CACTCCCCTACCCCCAGTTGAGG - Intergenic
1119713660 14:76842833-76842855 CACTCACCTTACCTGAGTTGTGG - Intronic
1122292704 14:100688169-100688191 CACTGCCCTGCTCACAGCTGGGG + Intergenic
1129616073 15:77099537-77099559 TCCTCACCTGCTCTCTCTTGGGG + Intergenic
1131018718 15:89079849-89079871 CTTTCCCCAGCTCTCAGTTGAGG + Intergenic
1131279927 15:91012890-91012912 CCCTCAGCTGCTCAAAGTTGGGG + Intronic
1132067511 15:98744392-98744414 CATTCATCAGCTCTCAGGTGAGG - Intronic
1132398174 15:101489367-101489389 CACTCACCTGGCCCAAGTTGAGG + Exonic
1136146232 16:28318065-28318087 CAATCACCATCTCTCAGGTGAGG + Intronic
1137432815 16:48432351-48432373 CACTCCCCTGCACTCCATTGAGG - Intronic
1137508385 16:49076576-49076598 CAGTCACTTGCTCTGTGTTGGGG + Intergenic
1142302232 16:89265445-89265467 CACTCACCTGCTCTGTGCTTTGG + Intergenic
1143563762 17:7709477-7709499 CACTCACCTTCTCATAGTGGGGG - Exonic
1143763471 17:9121557-9121579 CACTCACATGCTCTCTGCAGAGG + Intronic
1148907789 17:50922226-50922248 TTCTCACCAGCTCTCAGTGGAGG - Intergenic
1152226256 17:79094264-79094286 CCCTCACGCCCTCTCAGTTGCGG - Intronic
1152901476 17:82943518-82943540 CCCTGGCCTGCTCTCAGGTGGGG + Intronic
1160363940 18:78308325-78308347 CGCTCACCTGCTCTCAGGAGGGG + Intergenic
1161108301 19:2455392-2455414 CACTCACACCCCCTCAGTTGGGG + Intronic
1161251077 19:3280685-3280707 GTCTCACCTGTTCTCAGGTGTGG + Intronic
1162247523 19:9414690-9414712 CACTGACCTCCCCTCCGTTGTGG + Exonic
1163244747 19:16086525-16086547 CACTCACCTCCTCGTATTTGCGG - Exonic
1165003051 19:32780670-32780692 CACTCACCTGCTCACAGCCCAGG - Intronic
1167109953 19:47454348-47454370 CATCCACATGCCCTCAGTTGAGG - Intronic
1167497876 19:49830071-49830093 ATCCCTCCTGCTCTCAGTTGGGG + Exonic
1167719231 19:51167426-51167448 CACTCACCTGCCCACAGCAGGGG - Intergenic
1167727294 19:51225140-51225162 CACTCACCTGCCCACAGCAGGGG - Exonic
1167772853 19:51531575-51531597 CACTCACCTGCCCACAGCAGGGG + Exonic
925364546 2:3303055-3303077 CTCACAGCTGCACTCAGTTGTGG + Intronic
925909445 2:8564060-8564082 CACTCACCTGCCCTCAGATTCGG - Intergenic
926344630 2:11934066-11934088 CAATCACTTCCTCTCACTTGAGG + Intergenic
927645254 2:24873334-24873356 CCCTCACCTGCTGGCAGGTGGGG - Intronic
927973932 2:27323482-27323504 CACTCATGAGCTCACAGTTGAGG - Intronic
932090007 2:68797875-68797897 CACTCACCCTCTCCCATTTGGGG + Intronic
934513480 2:94967817-94967839 CTCTCCCCAGATCTCAGTTGAGG - Intergenic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935123755 2:100204345-100204367 CTCTCACCTTCTCTCCCTTGGGG + Intergenic
935208685 2:100919966-100919988 CACTGAGCTGCTTTTAGTTGAGG + Intronic
935284415 2:101551324-101551346 CTCACACTTGCTCTGAGTTGAGG + Intergenic
943904517 2:193480721-193480743 CACACCCCTGCTCTCCCTTGAGG - Intergenic
946717502 2:222568076-222568098 CACACACCTGCTCACATTTTTGG - Intergenic
946799511 2:223397760-223397782 CACACACATACTCTCAGTTGTGG + Intergenic
947858640 2:233342408-233342430 CACTCCCATGCTCTGAGATGCGG - Intronic
1173457094 20:43211666-43211688 CACTCACCAGCTCTGACTTTGGG - Intergenic
1174242872 20:49152280-49152302 CATTTCCCTGCTCTCTGTTGGGG - Intronic
1178342888 21:31801091-31801113 GACTCACCAGCTCTGAATTGGGG + Intergenic
1178850008 21:36205223-36205245 CACTCACCTGCTCTCAGTTGTGG + Intronic
1181114248 22:20621257-20621279 CCCTCACCTGCTCCCAGGTAAGG - Intergenic
952526267 3:34213632-34213654 CACCTGCCTGCTCTCAGCTGGGG - Intergenic
954590200 3:51776445-51776467 CACTCACCTCCTCTTCCTTGGGG + Intergenic
955563742 3:60222352-60222374 CATTCACCTGCTCTCTGGTATGG + Intronic
956818216 3:72928435-72928457 CTCTCTCCAGCTCCCAGTTGAGG + Intronic
957338155 3:78858819-78858841 TACTCACCTACTCTCATTTCAGG - Intronic
958454539 3:94313547-94313569 CATACACCTGCACTCACTTGTGG + Intergenic
959979377 3:112498161-112498183 CACTCTACTGCACTCAGTTTGGG - Intronic
961357444 3:126348006-126348028 CACTCACCTACTCCCCGTGGGGG - Intronic
962251826 3:133840451-133840473 CTCCCACCTGCACTCAGGTGTGG + Intronic
963727509 3:148938539-148938561 CACACACCAGCCCTCAGTTCTGG + Intergenic
967331743 3:188296912-188296934 CACTCCCTTGTTCTCAGATGAGG - Intronic
968460066 4:720382-720404 CACTCTGCTGCTCTCCCTTGTGG - Intronic
968717952 4:2175757-2175779 CACTCCTCTGCTCTCAGATGGGG + Intronic
968843009 4:3021860-3021882 CACCCGCCTGCACTCAGTGGGGG + Intronic
971424484 4:26502686-26502708 CACTGCCCTGATCTCAGTTAGGG + Intergenic
978422426 4:108546888-108546910 CAGTCACCAGGTCTCAGTGGTGG - Intergenic
978857708 4:113412073-113412095 CATTTTCCTGCTGTCAGTTGAGG - Intergenic
983547930 4:168982190-168982212 CACTCACATGCTCAAAGTTAAGG + Intronic
984180657 4:176478843-176478865 CAGTCACCTGTTCTTATTTGAGG - Intergenic
986352798 5:6895876-6895898 CACCCACCTGGCCTCAGTGGAGG - Intergenic
986681294 5:10235179-10235201 CACTTTCCTGCTCTCTGTTTGGG - Intronic
987198889 5:15554646-15554668 GACCCACCTGTTCTCAGGTGGGG - Intronic
992068691 5:73130056-73130078 CACTCACGTCTTCTCAGTTGGGG - Intronic
997475269 5:134139023-134139045 CACTCACCAGCTCACAGTGTGGG - Exonic
998846278 5:146313317-146313339 GACTCCCCAGCTCTCAATTGCGG + Intronic
999588261 5:153115371-153115393 CACTCACCTCCTCACAGGGGAGG + Intergenic
1005082042 6:21965980-21966002 CACTCACTTGGACTCAGTTCAGG - Intergenic
1005197752 6:23309086-23309108 CACTCAACTGCTCTGTGCTGGGG - Intergenic
1006784319 6:36655129-36655151 CACTCCCTTGCTCCCATTTGAGG + Intergenic
1007313356 6:40964137-40964159 CACTCACCTGCTCAGGGTTTTGG - Intergenic
1011732618 6:90281094-90281116 CACTCAACTACTCTCAGGTCTGG - Intronic
1019102534 6:169642729-169642751 CGCTCATCTGCTCCCAGGTGTGG + Intronic
1019255377 7:46439-46461 CACACACCTGCTTTGGGTTGGGG + Intergenic
1019315226 7:381065-381087 CACTCCCCTGCTCGCAGCTCAGG + Intergenic
1020379019 7:7521682-7521704 AACACACCTGCCCTCAGTTCAGG + Intronic
1020472607 7:8556167-8556189 TGCTCACCTTCTCTGAGTTGGGG - Intronic
1020637379 7:10713235-10713257 CAGTTACCCACTCTCAGTTGTGG + Intergenic
1020876353 7:13699709-13699731 CACTCAACTTCTCACAGTAGGGG - Intergenic
1021334481 7:19381794-19381816 CACTGACCTGTTCTTACTTGCGG - Intergenic
1021883540 7:25116209-25116231 AAGTCACCTGCACTGAGTTGGGG - Intergenic
1033290450 7:140078526-140078548 CTCTCACCTGCTCTCACCTGAGG + Intergenic
1034162346 7:149002709-149002731 CACTCAGCTGCTCCCAATTGTGG - Intergenic
1035079232 7:156202532-156202554 CAGTCACCTCCTCACAGATGTGG - Intergenic
1036806272 8:11836448-11836470 CCCTCACCTCCTCTGGGTTGTGG - Intronic
1038159574 8:25023741-25023763 GCATCACCTGCTCACAGTTGCGG - Intergenic
1042785276 8:72538191-72538213 CACTCACATGCACACACTTGTGG + Intronic
1044938267 8:97313936-97313958 CACTAACCTCCTCAAAGTTGGGG + Intergenic
1045011332 8:97961433-97961455 CACAGAGCTGCTCACAGTTGTGG - Exonic
1046542921 8:115610103-115610125 CACAAACCTCTTCTCAGTTGTGG + Intronic
1047769529 8:128019700-128019722 CACTTAGCTTCTCTCACTTGTGG + Intergenic
1048360778 8:133695460-133695482 GATTCACTGGCTCTCAGTTGTGG + Intergenic
1048817315 8:138345698-138345720 CTCTCCCCTCCTCTCAGTTTTGG - Intronic
1048980638 8:139702032-139702054 CCCTCAATTGCTCTCAGTAGAGG - Intronic
1056141115 9:83680801-83680823 GACTGACCAGCTCTAAGTTGGGG - Intronic
1056245845 9:84694473-84694495 CATTCACGTCCTCACAGTTGGGG + Intronic
1060239248 9:121888682-121888704 CACCCCCCTGCTCGTAGTTGAGG - Intronic
1061580791 9:131534611-131534633 CTCTTACCTGCTCTCTGGTGCGG + Intergenic
1061881124 9:133569563-133569585 CACTCACCCGCTCCCAGTCCTGG - Exonic
1062209232 9:135354456-135354478 CACTCATCTGCTCTCACCTGCGG - Intergenic
1062354003 9:136153370-136153392 CACTCACCAGCTCTGGGATGTGG - Intergenic
1187075385 X:15929608-15929630 CAGTCCCCTGCTCTCAGTTGGGG + Intergenic
1189546887 X:42050765-42050787 GACCCACCTGCTCTCATCTGAGG + Intergenic
1189546936 X:42051123-42051145 ACTTCACCTGCTCTCATTTGAGG + Intergenic
1190101811 X:47527833-47527855 CTCTCCCCTCCTCTCACTTGTGG + Intergenic
1190454889 X:50617807-50617829 CACTCACTTGCCCTGTGTTGGGG + Intronic
1192168479 X:68840555-68840577 CACTCACCTTCTCATAGTGGGGG - Exonic
1194449340 X:94024895-94024917 CAGTTACCTGCTGTCAATTGTGG - Intergenic
1196003162 X:110807970-110807992 CACCCACCTTCTCTCTTTTGTGG + Intergenic
1198027165 X:132718557-132718579 CAGTCCCCAGCTCTCAGTGGAGG - Intronic
1199109663 X:143915889-143915911 CACACGCCTGCTCTCAGCTCAGG - Intergenic
1199893260 X:152109320-152109342 CCCTCACCTGTGCTCACTTGAGG + Intergenic
1200214910 X:154363878-154363900 CACTAACCTGCTTTCTGCTGTGG - Intronic
1201755873 Y:17484766-17484788 CACACACCCACTCCCAGTTGGGG + Intergenic
1201845679 Y:18421219-18421241 CACACACCCACTCCCAGTTGGGG - Intergenic
1202070852 Y:20990260-20990282 CACCCACACACTCTCAGTTGAGG - Intergenic