ID: 1178862674

View in Genome Browser
Species Human (GRCh38)
Location 21:36302351-36302373
Sequence CAATATGTACATATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178862673_1178862674 -5 Left 1178862673 21:36302333-36302355 CCTCTACTTTACTTTTTACAATA No data
Right 1178862674 21:36302351-36302373 CAATATGTACATATGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178862674 Original CRISPR CAATATGTACATATGAAGCT AGG Intergenic
No off target data available for this crispr