ID: 1178863613

View in Genome Browser
Species Human (GRCh38)
Location 21:36309610-36309632
Sequence TGAAAAAGGGAGACCCGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178863613_1178863624 8 Left 1178863613 21:36309610-36309632 CCCGGCCGGGTCTCCCTTTTTCA No data
Right 1178863624 21:36309641-36309663 GGAGTGCAGTGGCACAATCAGGG 0: 1878
1: 20334
2: 65721
3: 128216
4: 142490
1178863613_1178863619 -3 Left 1178863613 21:36309610-36309632 CCCGGCCGGGTCTCCCTTTTTCA No data
Right 1178863619 21:36309630-36309652 TCACCCAGACCGGAGTGCAGTGG 0: 41
1: 4199
2: 93627
3: 182695
4: 208103
1178863613_1178863623 7 Left 1178863613 21:36309610-36309632 CCCGGCCGGGTCTCCCTTTTTCA No data
Right 1178863623 21:36309640-36309662 CGGAGTGCAGTGGCACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178863613 Original CRISPR TGAAAAAGGGAGACCCGGCC GGG (reversed) Intergenic
No off target data available for this crispr