ID: 1178864534

View in Genome Browser
Species Human (GRCh38)
Location 21:36316971-36316993
Sequence GAGGGTGAACAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178864534_1178864543 23 Left 1178864534 21:36316971-36316993 CCACCCTGCTTCTGTTCACCCTC No data
Right 1178864543 21:36317017-36317039 GCAGTCTCAATGAGATGAGCCGG No data
1178864534_1178864544 24 Left 1178864534 21:36316971-36316993 CCACCCTGCTTCTGTTCACCCTC No data
Right 1178864544 21:36317018-36317040 CAGTCTCAATGAGATGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178864534 Original CRISPR GAGGGTGAACAGAAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr