ID: 1178864953

View in Genome Browser
Species Human (GRCh38)
Location 21:36319827-36319849
Sequence AGGTTTCACATGGACACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178864948_1178864953 15 Left 1178864948 21:36319789-36319811 CCAAACAGTCTACATTAATTTCC No data
Right 1178864953 21:36319827-36319849 AGGTTTCACATGGACACTGGTGG No data
1178864950_1178864953 -6 Left 1178864950 21:36319810-36319832 CCGTCTTTATTTCGTTAAGGTTT No data
Right 1178864953 21:36319827-36319849 AGGTTTCACATGGACACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178864953 Original CRISPR AGGTTTCACATGGACACTGG TGG Intergenic
No off target data available for this crispr