ID: 1178871678

View in Genome Browser
Species Human (GRCh38)
Location 21:36382481-36382503
Sequence TACAGGAGATTGAGAACAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 438}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178871678 Original CRISPR TACAGGAGATTGAGAACAAC GGG (reversed) Intronic
900221303 1:1510702-1510724 AACAGGAGTTTGAGACCAGCCGG - Intergenic
902027370 1:13394173-13394195 TCTAGGAGTTTGAGATCAACTGG - Intergenic
903428627 1:23274123-23274145 TCCAGGAGTTTGAGACCACCCGG - Intergenic
903852423 1:26316177-26316199 CACAGGAGTTTGAGACCACCCGG - Intronic
904733151 1:32610398-32610420 GTCAGGAGTTTGAGACCAACCGG - Intronic
905611043 1:39351796-39351818 GTCAGGAGTTTGAGAACAGCTGG - Intronic
906121231 1:43392623-43392645 GACAGGAGATTGAGACTATCTGG - Intronic
906349686 1:45047644-45047666 AATAGGATCTTGAGAACAACTGG + Intronic
906678917 1:47711747-47711769 TCCAGCAGTTTGAGAACCACTGG - Intergenic
906909492 1:49932272-49932294 AAAATTAGATTGAGAACAACTGG + Intronic
908058187 1:60315513-60315535 TACAGAAGATTCAGTACAGCAGG - Intergenic
908548138 1:65182129-65182151 GCCAGGAGTTTGAGACCAACTGG - Intronic
910402344 1:86849878-86849900 GTCAGGAGTTTGAGACCAACTGG - Intergenic
911835866 1:102617903-102617925 ATCAGGAGATCGAGAACATCTGG - Intergenic
912101425 1:106210923-106210945 TGCTGGAGATTGAGGAAAACTGG - Intergenic
912694791 1:111833085-111833107 TTACGGAGATTGAGAAGAACTGG + Intronic
912957650 1:114166814-114166836 TGCAGGAGATTGAGCTCTACGGG - Intergenic
913026282 1:114844608-114844630 TGCAGGAGTTTGAGAACAGCCGG - Intergenic
913693880 1:121305642-121305664 TACACAAGATTCAGAACAGCTGG - Intronic
913963648 1:143357408-143357430 CTCAGGAGTTTGAGACCAACTGG - Intergenic
914058008 1:144182997-144183019 CTCAGGAGTTTGAGACCAACTGG - Intergenic
914121138 1:144783368-144783390 CTCAGGAGTTTGAGACCAACTGG + Intergenic
914143684 1:144974424-144974446 TACACAAGATTCAGAACAGCTGG + Intronic
914257208 1:145970354-145970376 TCCAGGAGTTTGAGACCAGCCGG - Intronic
915474221 1:156143504-156143526 TCCAGGAGTTTGAGACCAGCTGG + Intergenic
916894631 1:169149828-169149850 TACAGTTGATTGAGAGTAACTGG + Intronic
916950043 1:169770753-169770775 TAAAGGAGATTGAGAATCACAGG + Intronic
916970355 1:170006985-170007007 AAAAGGAGACTGAGAACGACTGG + Intronic
917721147 1:177787714-177787736 TACAGGAGATTTTGATCAATTGG + Intergenic
918120367 1:181532860-181532882 TACTGGAGATGGAGAACACCTGG + Intronic
918218442 1:182414157-182414179 CCCAGGAGTTTGAGACCAACGGG + Intergenic
918690059 1:187468500-187468522 CAAAGGAGATTTAGAACAATTGG - Intergenic
920202798 1:204270197-204270219 TAGAGGAGATTGAGAAGGAGTGG - Intronic
920339909 1:205269284-205269306 TGAAGGAGATTGAGCAGAACGGG + Exonic
920481204 1:206324021-206324043 TACACAAGATTCAGAACAGCTGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
920731629 1:208491538-208491560 TACATAAAATTGGGAACAACAGG - Intergenic
921007164 1:211105441-211105463 TAAAGGAAATTTAGAACTACTGG - Intronic
921649044 1:217654920-217654942 GTCAGGAGATTGAGACCATCTGG - Intronic
922995770 1:229958773-229958795 TAAAGGGGTTTGAGAACAAATGG + Intergenic
923902149 1:238337796-238337818 GTCAGGAGATTGAGACCATCCGG - Intergenic
1063379247 10:5574158-5574180 TACAGGAGGTTCAGGACAATAGG + Intergenic
1065181142 10:23127641-23127663 CCCAGGAGTTTGAGACCAACCGG - Intergenic
1065677462 10:28193421-28193443 GTCAGGAGATTGAGACCATCTGG - Intronic
1065835163 10:29650737-29650759 GTCAGGAGTTGGAGAACAACTGG + Intronic
1066115517 10:32235814-32235836 TACAGGAGACAGAGAAGAAATGG - Intergenic
1067394924 10:45906366-45906388 GACAAGAGACTGAGAACAAAGGG + Intergenic
1067535951 10:47110103-47110125 TTCAGGAGATTGAGCTCAGCTGG + Intergenic
1067863245 10:49875497-49875519 GACAAGAGACTGAGAACAAAGGG + Intronic
1068403741 10:56563811-56563833 TACAGGAGACAGAGAAATACTGG + Intergenic
1068434354 10:56971488-56971510 CAAAGGAGATGGAGAACAGCTGG - Intergenic
1072390810 10:94984964-94984986 TACAGGAGATGGAAAGTAACAGG - Intronic
1072813821 10:98485454-98485476 TGCAGGAGATTAAGAAGGACCGG - Intronic
1073271819 10:102271247-102271269 GTCAGGAGATTGAGACCATCTGG - Intronic
1073801468 10:107046154-107046176 TTCAAGAGATTGAGACCATCTGG - Intronic
1074447370 10:113531530-113531552 GTCAGGAGATTGAGACCAGCTGG - Intergenic
1074479185 10:113803046-113803068 CCCAGGAGTTTGAGACCAACTGG - Intergenic
1075239500 10:120765089-120765111 TAGAGGAGAATGAGACCAGCGGG - Intergenic
1075752726 10:124786601-124786623 GTCAGGAGTTTGAGAACAGCTGG + Intronic
1075857639 10:125643529-125643551 GTCAGGAGATTGAGACCATCTGG + Intronic
1077294787 11:1821143-1821165 CATAGGAGCTTGAGAACAACGGG + Intergenic
1077578274 11:3400718-3400740 TACAGAAGCCTGAGAACCACAGG - Intergenic
1077941967 11:6852295-6852317 GTCAGGAGATTGAGACCATCTGG + Intergenic
1078937623 11:15965480-15965502 TACAGGACATTGGAAAGAACAGG - Intergenic
1079532709 11:21474276-21474298 TAAAAGAGAGTGAGAACCACAGG - Intronic
1080134788 11:28842020-28842042 GCCAGGAGATAGAGAAAAACTGG - Intergenic
1081121609 11:39273430-39273452 GTCAGGAGTTTGAGACCAACCGG - Intergenic
1082072398 11:47949659-47949681 TTCAGGAGTTTGAGACCAGCTGG + Intergenic
1082832548 11:57629688-57629710 GTCAGGAGATTGAGACCATCTGG + Intergenic
1083889996 11:65591171-65591193 GTCAGGAGATTGAGACCATCTGG + Intronic
1084137920 11:67200979-67201001 GTCAGGAGATTGAGACCATCTGG + Intronic
1084157337 11:67321228-67321250 GACAGGGGATAGAGCACAACTGG + Intronic
1084879063 11:72156910-72156932 TGCAGGAGTTTGAGGTCAACTGG - Intergenic
1085122869 11:73978400-73978422 CCCAGGAGATGGAGAAAAACTGG + Exonic
1085357983 11:75856887-75856909 TACAGGAGATGGATCACAGCTGG - Intronic
1085639782 11:78186163-78186185 TTCAGGAGTTTGAGACCACCTGG + Intronic
1085856928 11:80185828-80185850 TATAGGAGAGAGAGAGCAACAGG - Intergenic
1087156046 11:94905023-94905045 GAAAGGAGATTGAGAGAAACAGG + Intergenic
1087460851 11:98445217-98445239 TACAGAAGATTGGTAACAAATGG - Intergenic
1088482629 11:110309530-110309552 TACATCAAATTGAGAACAGCAGG - Intergenic
1088754090 11:112871504-112871526 TACATGGAATTGAGATCAACAGG + Intergenic
1089401956 11:118169451-118169473 GACAGCAGACTGAGAACAGCTGG + Intronic
1089521116 11:119064299-119064321 GCCAGGAGTTTGAGACCAACCGG + Intergenic
1089850547 11:121492438-121492460 TACAGGAGATTGGGAGTAATGGG - Intronic
1090855915 11:130609248-130609270 TGAAGGAGGCTGAGAACAACCGG + Intergenic
1092816395 12:12315901-12315923 TCCAGGAGTTTGAGACCAGCTGG - Intergenic
1092834323 12:12473180-12473202 GTCAGGAGTTTGAGACCAACCGG - Intergenic
1093281480 12:17201805-17201827 GTCAGGAGATTGAGACCATCTGG + Intergenic
1093897126 12:24586431-24586453 TAAAGGAGATTGTGGAGAACTGG - Intergenic
1094123822 12:27001553-27001575 TCCAGGAGCTTAAGAACCACTGG + Intronic
1097668182 12:62505467-62505489 TACAAGAGACTGAGAACACAAGG + Intronic
1097814973 12:64063227-64063249 GACAGGAGAGAGAAAACAACTGG - Intronic
1098453461 12:70646124-70646146 TACAGTAAATTTAGAACAAAAGG + Intronic
1099059988 12:77895934-77895956 TACTGGAAATTGAGATCAAAAGG - Intronic
1099977685 12:89563276-89563298 TTCAGGAGTTTGAGACCAGCTGG - Intergenic
1100673031 12:96836629-96836651 AACAGGAGCTTGAGAAAAAATGG - Intronic
1101198745 12:102412795-102412817 AAATGGAGATTGAGAACAATAGG - Intronic
1102043921 12:109817839-109817861 TACAGGAGAGGGAGCACTACTGG + Intronic
1102280771 12:111617040-111617062 GTCAGGAGATTGAGACCATCTGG + Intergenic
1102768416 12:115452420-115452442 TACAGGAGACAGGGAGCAACTGG - Intergenic
1103096136 12:118134061-118134083 TCCAGGAGTTTGAGACCAGCCGG - Intronic
1104674660 12:130704363-130704385 GTCAGGAGTTTGAGACCAACTGG + Intronic
1104732144 12:131113195-131113217 TACAGCAAATTGAGAAAAACTGG - Intronic
1104833268 12:131769506-131769528 TACAGCAGATTGGGAAAAACTGG - Intronic
1105295100 13:19082009-19082031 TAGATGAAATTGAGAAGAACTGG - Intergenic
1105478276 13:20748222-20748244 GTCAGGAGATTGAGACCATCTGG + Intronic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1107649288 13:42527972-42527994 TTCAGGAGTTTGAGACCAGCTGG + Intergenic
1107905844 13:45060623-45060645 TGCAGGAGTTTGAGACCAGCAGG + Intergenic
1108078209 13:46703828-46703850 TGCAGGAAATTTAGAAAAACTGG + Intronic
1108330765 13:49380049-49380071 TTCAGGAGATCGAGACCATCTGG - Intronic
1108720215 13:53123863-53123885 AACAGGAGTTTGAGACCAGCTGG + Intergenic
1108882976 13:55143737-55143759 TCCAGGAGTTTGAGATCAGCTGG - Intergenic
1109059609 13:57597928-57597950 TCCAGGAGTTTGAGACCAGCTGG + Intergenic
1109488670 13:63064530-63064552 GTCAGGAGATTGAGACCATCTGG + Intergenic
1111385875 13:87526673-87526695 TAAAGGAGGTTCAGAACAACTGG - Intergenic
1111668829 13:91302918-91302940 TACAGGAGAGTGATGACAAAGGG - Intergenic
1111925716 13:94461416-94461438 TCCAGGAGTTTGAGACCACCTGG - Intronic
1112218721 13:97464635-97464657 TAAAGGAGACTGAGGACAAATGG - Exonic
1112358458 13:98694812-98694834 ATCAGGAGATTGAGACCATCTGG + Intronic
1112423456 13:99274926-99274948 CACAGGAGTTTGAGACCAGCCGG - Intronic
1112633362 13:101186158-101186180 TAAGGCAGATTGGGAACAACTGG + Intronic
1115634367 14:35277234-35277256 GTCAGGAGTTTGAGAGCAACCGG - Intronic
1115927966 14:38458198-38458220 TTCAGGTGATTGAACACAACAGG + Intergenic
1116263428 14:42659917-42659939 GTCAGGAGTTTGAGACCAACCGG + Intergenic
1118239305 14:64040378-64040400 TACAGTACTTTGAGAACAAAAGG + Intronic
1118427000 14:65676361-65676383 CACAGGAAATTAAGAACACCTGG - Intronic
1118745150 14:68768064-68768086 CCCAGGAGATGGAGAACAGCCGG + Intergenic
1119375204 14:74185523-74185545 GTCAGGAGATTGAGACCATCCGG - Intronic
1119794952 14:77387838-77387860 TCCAGGAGTTTGAGACCAGCTGG + Intronic
1119875357 14:78054728-78054750 TAAAAGAGATGGAGAACAAAGGG - Intergenic
1120803454 14:88719173-88719195 CTCAGGAGTTTGAGATCAACTGG + Intronic
1120887475 14:89463076-89463098 GTCAGGAGATTGAGAAGATCTGG + Intronic
1121850043 14:97213333-97213355 GTCAGGAGTTTGAGACCAACTGG - Intergenic
1122751331 14:103935720-103935742 AAAAGGAGACTGAGAACAAGTGG + Intronic
1124427839 15:29577562-29577584 CTCAGGAGTTTGAGACCAACTGG - Intergenic
1124610591 15:31205349-31205371 GTCAGGAGATTGAGACCATCCGG + Intergenic
1125403451 15:39328749-39328771 TTCGGGAGCTTGGGAACAACAGG - Intergenic
1125683639 15:41549165-41549187 GTCAGGAGATTGAGACCATCTGG - Intergenic
1125692946 15:41611419-41611441 GTCAGGAGATTGAGACCATCTGG - Intergenic
1125931805 15:43605404-43605426 TACAGCAATTTGACAACAACAGG + Intronic
1126596055 15:50385194-50385216 GTCAGGAGTTTGAGAACAAATGG + Intergenic
1127013371 15:54655225-54655247 CACTGGAGATTCAGAAGAACAGG + Intergenic
1127727605 15:61765429-61765451 TTGAGGAGGTTGAGAACAAATGG + Intergenic
1128059347 15:64724782-64724804 CCCAGGAGTTTGAGACCAACCGG + Intergenic
1129000973 15:72333582-72333604 TCCAGGAGTTTGAGAGCAACTGG - Intronic
1131233663 15:90678156-90678178 TACAGGATAACGAGAACACCTGG - Intergenic
1131956140 15:97738328-97738350 TAAAGATGAATGAGAACAACTGG + Intergenic
1132121895 15:99183549-99183571 GTCAGGAGATTGAGACCATCTGG - Intronic
1132264123 15:100451489-100451511 GTCAGGAGATTGAGACCATCCGG + Intronic
1133338095 16:5019618-5019640 GTCAGGAGATTGAGACCATCTGG + Intergenic
1134822170 16:17255795-17255817 GTCAGGAGTTTGAGACCAACGGG + Intronic
1135408686 16:22216949-22216971 TCCAGGAGTTTGAGACCAGCTGG + Intronic
1135877409 16:26215987-26216009 AACAGGAGATGGAGAAGAAAGGG - Intergenic
1136617775 16:31409081-31409103 GTCAGGAGTTTGAGACCAACTGG + Intronic
1137311968 16:47271645-47271667 GTCAGGAGATTGAGACCATCTGG + Intronic
1137480025 16:48844609-48844631 TATATGAGATGGAGAGCAACTGG + Intergenic
1137546063 16:49404555-49404577 TCCAGGGGTTTGAGACCAACTGG - Intergenic
1138258485 16:55593409-55593431 TACAATAGAATGAGAACAATTGG + Intergenic
1138459909 16:57142020-57142042 TACAGGAAATTGAGAGCAGGTGG + Intronic
1140395712 16:74624783-74624805 GATAGGAGATTGAGACCAGCTGG + Intronic
1141696750 16:85623866-85623888 TACAGGAGCTGGACACCAACAGG - Intronic
1142161433 16:88559630-88559652 GTCAGGAGATTGAGACCATCCGG - Intergenic
1142868908 17:2808117-2808139 GACAGAAGGGTGAGAACAACGGG - Intronic
1143042267 17:4047432-4047454 TCCAGGAGTTCGAGACCAACCGG + Intronic
1143690582 17:8561036-8561058 TACAGGATATTGTGAGCAAGTGG - Intronic
1144248128 17:13387853-13387875 ATCAGGAGATGGAGACCAACTGG - Intergenic
1145094731 17:20015997-20016019 GTCAGGAGATTGAGACCATCTGG + Intronic
1146048072 17:29526914-29526936 GTCAGGAGATTGAGACCATCTGG + Intronic
1146239905 17:31210370-31210392 ACCAGGAGTTTGAGACCAACTGG + Intronic
1146781455 17:35677198-35677220 CCCAGGACATTGAGACCAACTGG - Intronic
1147111001 17:38261460-38261482 AACTGGAGAGTCAGAACAACAGG - Intergenic
1148418509 17:47526981-47527003 AACTGGAGAGTTAGAACAACAGG + Intronic
1149116895 17:53108331-53108353 GTCAGGAGATTGAGACCATCTGG - Intergenic
1149267159 17:54939394-54939416 AACAGGAGATGGGGAAGAACAGG + Intronic
1149967645 17:61182082-61182104 GCCAGGAGTTTGAGACCAACAGG - Intronic
1150215418 17:63466014-63466036 GTCAGGAGATTGAGACCATCTGG + Intergenic
1150856780 17:68760672-68760694 GTCAGGAGATTGAGACCACCTGG + Intergenic
1151385263 17:73751397-73751419 CAAAGGAGTCTGAGAACAACCGG - Intergenic
1151844547 17:76643241-76643263 TACAGGAGTTTGAGAACTGATGG - Intronic
1152023032 17:77791198-77791220 GTCAGGAGATTGAGACCATCCGG + Intergenic
1152729953 17:81964950-81964972 TCCAGGAGATGGAGAGAAACAGG + Intergenic
1153461648 18:5340919-5340941 AAAAGGAGATTGACAACAAAAGG - Intergenic
1153699001 18:7673821-7673843 TCAAGGACATTGGGAACAACAGG + Intronic
1153741779 18:8137552-8137574 AACAGTACCTTGAGAACAACTGG - Intronic
1153770113 18:8408448-8408470 TCCAAGAGATTGAAAACAACTGG - Intergenic
1153846305 18:9052643-9052665 GACAGGAGGTTGACAACAAGGGG + Intergenic
1156229585 18:35140460-35140482 AACGGCAGATTGGGAACAACTGG - Exonic
1157296379 18:46448038-46448060 TATAGGAGGTTGAGAACACAGGG - Intronic
1157337713 18:46753817-46753839 AATAGGGGATTGAGAACCACTGG + Intronic
1157973508 18:52298832-52298854 GCCAGGAGTTTGAGACCAACTGG + Intergenic
1158103599 18:53859423-53859445 GTCAGGAGATTGAGACCAACCGG + Intergenic
1158249168 18:55467497-55467519 CACAGGAGTTTGAGAACCACAGG + Intronic
1160597207 18:79984381-79984403 GACAGGAGTTTGAGACCAGCCGG + Intronic
1160970349 19:1765160-1765182 TAGAGGAGATGGAGACCAGCTGG - Intronic
1161451486 19:4348469-4348491 GTCAGGAGTTTGAGAACAGCCGG - Intronic
1163038932 19:14588275-14588297 GACAGGAGTTTGAGACCAGCCGG + Intronic
1163177572 19:15575310-15575332 TTCAGGAGATTGAGACCATCTGG - Intergenic
1163198724 19:15746330-15746352 TCCAGGAGTTTGAGACCAACTGG - Intergenic
1163480652 19:17554267-17554289 ACCAGGAGTTTGAGAACAGCCGG + Intergenic
1165028921 19:32983298-32983320 GTCAGGAGATTGAGACCATCGGG + Intronic
1165085767 19:33345889-33345911 CACAGGAGTTTGAGACCAGCCGG + Intergenic
1165792097 19:38498909-38498931 AACAGGAGCTTGAGACCTACTGG - Intronic
1166160744 19:40951022-40951044 CACAGGGGATTGAGAGTAACTGG - Intergenic
1166310662 19:41960598-41960620 TCCAGGAGTTTGAGACCTACTGG - Intergenic
1167392225 19:49203101-49203123 GTCAGGAGATTGAGACCATCCGG - Intronic
1202697491 1_KI270712v1_random:135665-135687 CTCAGGAGTTTGAGACCAACTGG - Intergenic
925501066 2:4505428-4505450 TAAAGGGGATTGAGATCATCTGG - Intergenic
926530721 2:14041177-14041199 TACAGGATATTGAGAAAGAATGG - Intergenic
927969288 2:27294677-27294699 GTCAGGAGATTGAGACCATCTGG + Intronic
928270605 2:29851536-29851558 TACCTAAGCTTGAGAACAACTGG - Intronic
928698315 2:33872696-33872718 TCCAGGAGTTTGAGACCAGCCGG + Intergenic
929202234 2:39247891-39247913 TTGAGGAGAATGAGATCAACCGG - Intergenic
931081942 2:58783601-58783623 CAAAAGAGACTGAGAACAACTGG - Intergenic
931809868 2:65844381-65844403 TACAGCAGATTGTGAACTATAGG + Intergenic
933377037 2:81492751-81492773 TACAAGAAATTGAGTAAAACCGG - Intergenic
933599092 2:84311702-84311724 TTCAGGAGTTTGAGACCAGCCGG + Intergenic
934278663 2:91592689-91592711 CTCAGGAGTTTGAGACCAACTGG - Intergenic
936100532 2:109574226-109574248 TCCAGGAGTTTGAGACCAACTGG + Intronic
937448958 2:121984571-121984593 TTCAGGAATTTGAGACCAACTGG - Intergenic
937821477 2:126315414-126315436 GTCAGGAGATTGAGACCATCTGG - Intergenic
938099460 2:128488429-128488451 TACAGGAGAGTTAGCACACCTGG + Intergenic
938452330 2:131433031-131433053 TAAAGGAGATTAAAAACAACTGG + Intergenic
938818784 2:134932209-134932231 GTCAGGAGTTTGAGACCAACAGG - Intronic
939300162 2:140326503-140326525 GTCAGGAGATTGAGACCAGCTGG + Intronic
940516298 2:154687696-154687718 GTCAGGAGATTGAGACCAGCTGG - Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
942605166 2:177683036-177683058 GACAAGAGGTTGAGAACAACTGG + Intronic
944252055 2:197588423-197588445 GCCAGGAGTTTGAGACCAACTGG - Intronic
945050438 2:205819030-205819052 GTCAGGAGATTGAGACCATCCGG - Intergenic
945866702 2:215183695-215183717 TTCAGGAAATTGAGACCATCCGG + Intergenic
946274104 2:218617872-218617894 GTCAGGAGATTGAGACCATCTGG + Intronic
947137666 2:226991390-226991412 GTCAGGAGATTGAGACCATCCGG - Intronic
948970226 2:241419937-241419959 TCCAGGAGTTTGAGACCAGCTGG + Intronic
1169436990 20:5601577-5601599 GTCAGGAGTTTGAGACCAACTGG - Intronic
1169597605 20:7218515-7218537 GTCAGGAGTTTGAGAACAGCTGG + Intergenic
1170484365 20:16801321-16801343 GTCAGGAGATTGAGACCACCTGG - Intergenic
1172381215 20:34494016-34494038 CTCAGGAGTTTGAGAACAGCTGG + Intronic
1172398685 20:34630126-34630148 TACAGACCACTGAGAACAACAGG + Intronic
1173360638 20:42341526-42341548 CACAGGAGATGGAGAAGGACTGG - Intronic
1173801842 20:45898995-45899017 GAGAGGTGATTGAGAAGAACCGG - Exonic
1174253599 20:49237631-49237653 TAGATGTGATTGAGAACAGCAGG + Intronic
1174649214 20:52110532-52110554 TGAAGGAGACTGAGAAGAACTGG - Intronic
1174869144 20:54167429-54167451 GTCAGGAGTTTGAGACCAACCGG + Intronic
1175006980 20:55694675-55694697 GTCAGGAGATCGAGAACATCCGG + Intergenic
1175055250 20:56192030-56192052 TACAGGAGAGTAAGGACAGCAGG - Intergenic
1175620815 20:60445689-60445711 TACAGAACATTCAGAAGAACTGG - Intergenic
1177548044 21:22584465-22584487 TTCAGGGGTTTGAGAACAGCTGG - Intergenic
1178419043 21:32428916-32428938 TACAGAAGCCTGAGAACCACAGG + Intronic
1178871678 21:36382481-36382503 TACAGGAGATTGAGAACAACGGG - Intronic
1179072135 21:38081622-38081644 GTCAGGAGATCGAGAACAGCTGG + Intronic
1179234898 21:39536910-39536932 TATAGGAGTTTGAGACCAGCAGG + Intergenic
1179369756 21:40793699-40793721 GTCAGGAGATTGAGACCAGCGGG - Intronic
1180164378 21:46015049-46015071 AACAGGATATTGACATCAACAGG + Intergenic
1181164666 22:20976862-20976884 GACAGATGTTTGAGAACAACCGG + Exonic
1181255929 22:21562715-21562737 GTCAGGAGATTGAGAACACGGGG - Intronic
1181678825 22:24476946-24476968 TCCAGGAGTTTGAGACCAGCTGG - Intergenic
1181679013 22:24478350-24478372 TCCAGGAGTTTGAGACCAGCTGG + Intergenic
1182544687 22:31068092-31068114 GTCAGGAGTTTGAGACCAACGGG + Intronic
1183703323 22:39462109-39462131 GTCAGGAGCTTGAGAACATCTGG - Intronic
1183815854 22:40299597-40299619 CCTAGGAGATTGAGAACACCTGG - Intronic
1184271029 22:43384060-43384082 CTCAGGAGATTGAGACCACCTGG + Intergenic
949477752 3:4465262-4465284 GTCAGGAGATTGAGACCATCCGG + Intronic
949736725 3:7181130-7181152 AACAGAAGATTGGGAAGAACCGG - Intronic
949997100 3:9626709-9626731 TCCAGGAGTTTGAGATCAGCTGG - Intergenic
950064569 3:10101593-10101615 TTCAGGAGATTGAGACCATCTGG - Intronic
950290982 3:11784282-11784304 TTCAGGAGTTTGAGACCAGCTGG + Intergenic
950871297 3:16231848-16231870 TTCAGCAGATTGTGAACAATGGG + Intronic
951383132 3:22009992-22010014 TAAAGGAAATTGAGGAAAACAGG + Intronic
954889023 3:53905833-53905855 GTCAGGAGATTGAGACCATCTGG + Intergenic
955039389 3:55300335-55300357 TATAGGCCATTGAGAAGAACAGG - Intergenic
955157081 3:56427334-56427356 TCCAGGAGTTTGAGACCAGCTGG - Intronic
955382789 3:58453713-58453735 TTCAGGAGTTTGAGACCAGCCGG - Intergenic
955737641 3:62056727-62056749 TACTGCAGTTTGAGAACCACTGG + Intronic
956014251 3:64864500-64864522 GAGAGGAGATGGAGAATAACAGG + Intergenic
956277894 3:67522874-67522896 GTCAGGAGATTGAGACCATCTGG - Intronic
956578887 3:70787379-70787401 TAGAAGAGATTGTGTACAACTGG + Intergenic
956777217 3:72575313-72575335 CACAGGAGAATGAGAACAAGTGG + Intergenic
957179508 3:76858472-76858494 CTCAGGAGTTTGAGACCAACTGG - Intronic
961342878 3:126240913-126240935 GCCAGGAGTTTGAGAACACCTGG + Intergenic
961407261 3:126689224-126689246 GTCAGGAGATTGAGACCATCTGG - Intergenic
961681234 3:128601687-128601709 GTCAGGAGATTGAGACCATCTGG - Intergenic
961884918 3:130090451-130090473 TACAGAAGCCTGAGAACCACAGG - Intronic
962609165 3:137058699-137058721 GCCAGGAGTTTGAGACCAACTGG + Intergenic
962612249 3:137088024-137088046 TAGAAGAGATTGTGTACAACTGG + Intergenic
962771475 3:138614227-138614249 TTCAGGAGTTTGAGACCAGCTGG + Intronic
964225347 3:154393020-154393042 TAGAGGAGATTGAGAAGAATTGG - Intronic
964225734 3:154399163-154399185 TGGAGGAGGTTGAGAACCACTGG + Intronic
965140026 3:164820845-164820867 TCCAGGAGTTTGAGACCAGCCGG + Intergenic
965365317 3:167791594-167791616 TAAAGGAGTTTGAAAACAAATGG - Intronic
965746183 3:171928682-171928704 CACAGGAGTTTGAGACCAGCCGG + Intronic
966925881 3:184644306-184644328 TACAGGAGATTGACAAAAAGAGG - Intronic
967282404 3:187834746-187834768 CACAGGAGAATGAGAACACATGG - Intergenic
967423445 3:189299034-189299056 AACAGGAGATTTAGAAAAATGGG + Intronic
967915983 3:194578563-194578585 GCCAGGAGTTTGAGAACAGCTGG + Intergenic
968679422 4:1906448-1906470 CCCAGGAGTTTGAGACCAACTGG - Intronic
968994061 4:3934408-3934430 TACAGAAGCCTGAGAACCACAGG - Intergenic
969807321 4:9619390-9619412 GTCAGGAGATTGAGACCATCTGG + Intergenic
969819872 4:9711835-9711857 TACAGAAGCCTGAGAACCACAGG + Intergenic
970302579 4:14696914-14696936 GACAAGAGATTGAGACCATCTGG - Intergenic
971654293 4:29322128-29322150 TAAAAGTGATTCAGAACAACTGG - Intergenic
971928664 4:33048938-33048960 ATCAGGAGATTGAGAACATCTGG + Intergenic
972505303 4:39715238-39715260 GTCAGGAGATTGAGACCATCTGG - Intronic
972599015 4:40555275-40555297 GACAGGAGTTTGAGACCAGCTGG - Intronic
973082926 4:46017027-46017049 CCCAGGAGTTTGAGACCAACGGG - Intergenic
973959424 4:56095139-56095161 TCCAGGAGTTTGAGACCAGCTGG + Intergenic
974805485 4:66874652-66874674 TCCAGGAGTTCGAGACCAACCGG + Intergenic
974902958 4:68023454-68023476 TCCAGGAGTTTGAGACCAGCTGG + Intergenic
975156316 4:71076778-71076800 TGCAGGAGTTTGAGACCAGCTGG + Intergenic
976514708 4:85951489-85951511 TACAAAACATTGAAAACAACAGG - Intronic
977236381 4:94512229-94512251 GTCAGGAGATTGAGACCATCCGG - Intronic
977411776 4:96675151-96675173 GCCAGGAGTTTGAGGACAACTGG - Intergenic
979189605 4:117840062-117840084 TTCAGGAGTTTGAGACCAGCCGG - Intergenic
980314425 4:131178322-131178344 GTCAGGAGATTGAGACCATCCGG + Intergenic
980333917 4:131443909-131443931 GTCAGGAGATTGAGACCATCCGG - Intergenic
980623346 4:135339904-135339926 GTCAGGAGATTGAGACCATCTGG - Intergenic
982547539 4:156753801-156753823 AAAAGGAGCTTAAGAACAACTGG - Intergenic
983239238 4:165212850-165212872 AACAGGTGATTGAAAAGAACTGG - Intronic
984233820 4:177132178-177132200 TACAGGGGACAAAGAACAACAGG - Intergenic
985336155 4:188897243-188897265 CACAGGAGTTTGAGACCAGCCGG - Intergenic
986909706 5:12540116-12540138 TAGAGGAGAATGATAGCAACTGG + Intergenic
986951971 5:13099658-13099680 TTCATGAGATAGAGAACAAAAGG - Intergenic
986981059 5:13448452-13448474 CACAGGAGAAAGATAACAACTGG + Intergenic
989148805 5:38277001-38277023 TAGAGGAGTTTGAGAAAAATAGG - Intronic
989393763 5:40930414-40930436 ATCAGGAGTTTGAGACCAACAGG - Intronic
990489481 5:56290225-56290247 GCCAGGAGTTTGAGACCAACTGG - Intergenic
991309060 5:65214607-65214629 TACATGAGGTTGAAAACAAATGG + Intronic
991914959 5:71596727-71596749 GTCAGGAGATTGAGACCATCTGG + Intronic
992282598 5:75197110-75197132 GTCAGGAGATTGAGACCAGCTGG - Intronic
992809017 5:80367464-80367486 TCCAGGAGTTTGAGACCAGCCGG + Intergenic
993640704 5:90402060-90402082 CACAGGAGTTTGAGACCAGCTGG - Intronic
993653788 5:90553903-90553925 TAGAGGTGATTGGGAACACCTGG + Intronic
993735715 5:91475212-91475234 TAGAGGGGATGGAGAATAACAGG - Intergenic
994092087 5:95818483-95818505 TGCAGGAGAATAAGAACCACAGG - Intronic
994101716 5:95900726-95900748 TACAGGAGATTCTGAACGGCTGG + Exonic
994285906 5:97966831-97966853 TACAAGTTATTGTGAACAACTGG + Intergenic
995494342 5:112725541-112725563 TCCAGGAGTTTGAGACCAGCCGG + Intronic
996777194 5:127145488-127145510 TACATGAGTTTGAGAACCTCTGG - Intergenic
997333214 5:133082923-133082945 TTCAGGAGTTTGAGACCAGCTGG + Intronic
997770947 5:136552503-136552525 TGGAGTAGATTGAGAATAACTGG + Intergenic
997971533 5:138406842-138406864 TCCAGGAGTTTGAGACCAGCAGG + Intronic
998321603 5:141236859-141236881 GACAGGAGATTGGGAATCACCGG - Intergenic
998843415 5:146280265-146280287 TTCAGGAGTTTGAGACCAGCTGG - Intronic
999785526 5:154886545-154886567 GACAGGAGTTTGAGACCAGCTGG - Intergenic
999993720 5:157071792-157071814 TCCAGGAGTTTGAGACCAACCGG + Intergenic
1001363199 5:171108620-171108642 TTCAGGAGTTTGAGACCAGCTGG - Intronic
1002150968 5:177230613-177230635 GACAGGAGTTTGAGACCAGCTGG + Intronic
1005017220 6:21385779-21385801 TAAAGGAGAATGAGAAACACTGG - Intergenic
1005954354 6:30653347-30653369 TACTGGAGATTGAGAGCAGTTGG - Exonic
1007298147 6:40844399-40844421 CACAGGAAATGGAGAACAGCAGG + Intergenic
1008171128 6:48207338-48207360 TATAGGAGAGTGAGACCAGCTGG - Intergenic
1008439346 6:51514775-51514797 AACAGAAGATTAAAAACAACTGG + Intergenic
1008946902 6:57108048-57108070 TTCAGGAGATTGAGACCACCTGG - Intronic
1009297532 6:61972081-61972103 TACTGGAGATTGAGCAGAAAAGG - Intronic
1010466661 6:76175197-76175219 TGGAGGAGAATGAGAAAAACAGG - Intergenic
1010590325 6:77704672-77704694 TACTGGAGTTTGAGAATCACTGG + Intronic
1011701332 6:89957748-89957770 TCCAGGAGTTTGAGACCACCTGG - Intronic
1011816469 6:91197120-91197142 CACAGGAAATTGATCACAACTGG - Intergenic
1011845945 6:91562620-91562642 TTCAGGAGTTTGAGACCAGCCGG + Intergenic
1013161434 6:107549053-107549075 TTCAGGAGATCGAGACCATCTGG + Intronic
1013244409 6:108273174-108273196 CTCAGGAGTTTGAGACCAACCGG - Intergenic
1013722190 6:113043801-113043823 GTCAGGAGTTTGAGACCAACAGG + Intergenic
1014985891 6:128009048-128009070 TAAAGGATCTTGAGAAAAACAGG + Intronic
1015303814 6:131683961-131683983 GTCAGGAGATTGAGACTAACCGG - Intronic
1015946064 6:138502521-138502543 GCCAGGAGTTTGAGAACAGCCGG - Intronic
1016550002 6:145269147-145269169 TTCAGGAGATCGAGACCACCAGG - Intergenic
1017291242 6:152740717-152740739 TACAAGAAAGTGAGAACAAAAGG + Intergenic
1019452237 7:1105397-1105419 AGCAGGTGCTTGAGAACAACAGG + Intronic
1019454668 7:1120500-1120522 TTCAGGAGTTTGAGACCAGCCGG - Intronic
1019822282 7:3253931-3253953 TTGAGGAGTTTGAGACCAACCGG + Intergenic
1019833288 7:3355572-3355594 AACAGGGGATTGAGAAGAATGGG - Intronic
1020400485 7:7771045-7771067 TAAAGGAGCCTGAGAACAAATGG + Intronic
1020513061 7:9083842-9083864 TAGAGAAGATTGAGAAGTACTGG + Intergenic
1020890321 7:13869928-13869950 GTCAGGAGATTGAGACCATCTGG - Intergenic
1020917742 7:14217617-14217639 TACATGAGAAGGAGAAGAACAGG + Intronic
1021318693 7:19183988-19184010 TTCAGGAGTTTGAGACCAGCTGG + Intergenic
1021409971 7:20319345-20319367 ATCAGGATATTGAGCACAACTGG - Intergenic
1022643866 7:32212832-32212854 TGCTGAAGTTTGAGAACAACAGG - Intronic
1023409746 7:39877945-39877967 TTCAGGAGTTTGAGACCACCTGG - Intergenic
1023515602 7:40998154-40998176 GCCAGGAGGTTGAGACCAACCGG + Intergenic
1023813312 7:43929079-43929101 TCCAGGAGTTGGAGACCAACTGG + Intronic
1025043123 7:55665611-55665633 TTCAGGAGTTTGAGACCACCTGG + Intergenic
1026096489 7:67350657-67350679 GTCAGGAGATTGAGACCATCTGG + Intergenic
1026245937 7:68619641-68619663 TACAAGAAATTGAGAACATCTGG - Intergenic
1026332444 7:69364372-69364394 GTCAGGAGATTGAGACCATCCGG + Intergenic
1027138659 7:75641330-75641352 TTCAGGAGTTTGAGAACTCCTGG + Intronic
1027881062 7:83837103-83837125 ATCAGGAGTTTGAGAACAGCCGG - Intergenic
1028963543 7:96776434-96776456 TCAAGGAGATTGAGACCATCCGG - Intergenic
1029621543 7:101692999-101693021 GTCAGGAGTTTGAGAACAGCTGG - Intergenic
1030208303 7:106972231-106972253 GTCAGGAGTTTGAGACCAACTGG + Intergenic
1030504424 7:110401392-110401414 TACAGGAGAGTTACAAAAACAGG - Intergenic
1030713241 7:112778562-112778584 TACTGAAGATTGAGAAGCACTGG - Intronic
1031357200 7:120801296-120801318 TAGAGGAAATTGGGAACAACAGG - Intronic
1032243361 7:130184700-130184722 GTCAGGAGATTGAGACCATCTGG - Intronic
1032773628 7:135086900-135086922 TAAAAGAGTTTGAGAAGAACTGG + Intronic
1033130243 7:138739930-138739952 TCCAGGAGTTTGAGACCAGCTGG + Intronic
1033396431 7:140978478-140978500 TTCAGGAGTTTGAGACCAGCTGG - Intergenic
1035054107 7:156022526-156022548 GTCAGGAGATTGAGACCATCTGG - Intergenic
1035849496 8:2901265-2901287 TACAGCAGCTTCAGAACAGCAGG + Intergenic
1036382038 8:8242190-8242212 TACAGAAGCCTGAGAACCACAGG + Intergenic
1036589081 8:10151341-10151363 GACAGGAAATAGAGAACAGCAGG + Intronic
1038081588 8:24143313-24143335 GTCAGGAGTTTGAGACCAACTGG + Intergenic
1038412777 8:27371103-27371125 GCCAGGAGTTTGAGACCAACTGG - Intronic
1039699361 8:39946395-39946417 GTCAGGAGATTGAGACCATCTGG + Intronic
1039793429 8:40893084-40893106 TGCTGGAGATGGAGAACAGCTGG + Intronic
1040060127 8:43096448-43096470 GTCAGGAGATTGAGACCATCTGG + Intronic
1040422462 8:47252894-47252916 TAAAAGAGATTGAGAATAACTGG + Intergenic
1041057955 8:54007050-54007072 CTCAGGAGTTTGAGACCAACTGG - Intronic
1041060113 8:54026984-54027006 TTCAGGAGTTTGAGACCAGCCGG - Intergenic
1042021585 8:64375250-64375272 TATAGAAAAATGAGAACAACTGG + Intergenic
1044039538 8:87349583-87349605 GTCAGGAGTTTGAGAACACCTGG - Intronic
1044355079 8:91212977-91212999 TCCAGCAGTTTGAGAACAAAAGG - Intronic
1044743040 8:95346985-95347007 TTCAGGAGTTTGAGACCAGCTGG - Intergenic
1044968487 8:97596665-97596687 CCCAGGAGTTTGAGAACACCTGG - Intergenic
1045030011 8:98126057-98126079 TCCAGGAGTTTGAGACTAACTGG - Intronic
1045198543 8:99954661-99954683 CCCAGGAGTTTGAGACCAACCGG - Intergenic
1045673245 8:104580302-104580324 GTCAGGAGATTGAGACCATCAGG + Intronic
1046956167 8:120064928-120064950 GTCAGGAGTTTGAGACCAACCGG - Intronic
1047621264 8:126610705-126610727 ACCAGGAGTTTGAGAACAGCTGG - Intergenic
1048033499 8:130654777-130654799 GTCAGGAGATTGAGACCATCTGG + Intergenic
1048220424 8:132536125-132536147 CAAAGAAGATTGAGTACAACTGG - Intergenic
1049141031 8:140954278-140954300 TTCAGGAGTTTGAGACCAAGTGG - Intronic
1050990737 9:12148990-12149012 CACAGGAGGTTGAGCACAGCAGG - Intergenic
1051646437 9:19273161-19273183 GTCAGGAGATTGAGACCATCTGG - Intronic
1052226908 9:26100851-26100873 TACAAGAGATTGAGAATATTAGG + Intergenic
1053148804 9:35730146-35730168 TATAGGAGGTTGAGAAGAGCTGG + Intronic
1053529499 9:38865730-38865752 GTCAGGAGATTGAGACCATCTGG + Intergenic
1053567012 9:39264002-39264024 GTCAGGAGATTGAGACCATCTGG + Intronic
1054130131 9:61355005-61355027 GTCAGGAGATTGAGACCATCTGG - Intergenic
1054636634 9:67498202-67498224 GTCAGGAGATTGAGACCATCTGG - Intergenic
1054936554 9:70694690-70694712 GTCAGGAGATTGAGACCATCCGG - Intronic
1055376617 9:75655378-75655400 TAGCCAAGATTGAGAACAACTGG - Intergenic
1056640247 9:88363905-88363927 TAAAAGAGATTGTGTACAACTGG - Intergenic
1057013331 9:91628070-91628092 GACAGGATTTTGAGATCAACCGG - Intronic
1058844732 9:108945683-108945705 TCCAGGAGTTTGAGACCAGCTGG - Intronic
1058910977 9:109519700-109519722 GCCAGGAGATTGAGAATAAGAGG + Intergenic
1059134018 9:111786221-111786243 GTCAGGAGATTGAGACCATCTGG + Intronic
1059382962 9:113942749-113942771 TTCAGGAAAATGAGAAAAACTGG + Intronic
1060308615 9:122438989-122439011 TCCAGGAGTTTGAGACCAACTGG - Intergenic
1061832666 9:133305309-133305331 GTCAGGAGATTGAGACCATCTGG + Intergenic
1061852223 9:133422984-133423006 TCCAGGAGTTTGAGACCAGCTGG - Intronic
1062728072 9:138089063-138089085 TAGAAGAGCTTGAGAAGAACAGG - Intronic
1203792951 EBV:161328-161350 CATATGAGATTGAGAACATCAGG - Intergenic
1186016395 X:5199798-5199820 GTCAGGAGATTGAGACCATCTGG - Intergenic
1186650546 X:11555541-11555563 TTCAGGAGTTTGAGACCAGCCGG + Intronic
1187510506 X:19913498-19913520 TACTTGAGTTTGAGAATAACTGG - Exonic
1188658484 X:32730120-32730142 GCCAGGAGTTTGAGACCAACCGG + Intronic
1189313910 X:40040194-40040216 TTCAGGAGTTTGAGACCAGCTGG - Intergenic
1189631531 X:42959637-42959659 GTCAGGAGATTGAGACCAACCGG - Intergenic
1190002774 X:46705534-46705556 TCCAGGAGTTTGAGACCAGCTGG + Intronic
1190428186 X:50352190-50352212 TACCTGAGATTGAGACCAAAAGG - Intergenic
1190497509 X:51040775-51040797 TACACAACATTGAAAACAACTGG - Intergenic
1190708026 X:53047256-53047278 TTCAGGAGTTTGAGACCACCCGG - Intergenic
1193025745 X:76844062-76844084 AACAGGGTTTTGAGAACAACTGG - Intergenic
1194122808 X:89980355-89980377 TGCAACAGATGGAGAACAACTGG + Intergenic
1196384457 X:115133768-115133790 AATAGGAGATAGGGAACAACTGG - Intronic
1196999286 X:121420805-121420827 GTCAGGAGATTGAGACCATCCGG - Intergenic
1198471908 X:136954632-136954654 TTCAGGAGTTTGAGACCAGCTGG - Intergenic
1199333734 X:146593725-146593747 TACAGGATATTGAAAACAAATGG - Intergenic
1199751144 X:150819316-150819338 TATAGGATATTGAGAGCAAATGG - Intronic
1199893446 X:152110506-152110528 TACAGCAGATGGGAAACAACTGG + Intergenic
1200087856 X:153618537-153618559 GATTGGAGATTGAGAACAAGGGG - Intergenic
1200468701 Y:3555126-3555148 TAAAAGAGATTAAGAAGAACTGG - Intergenic
1200475667 Y:3637793-3637815 TGCAACAGATGGAGAACAACTGG + Intergenic
1201262685 Y:12175974-12175996 CTCAGGAGTTTGAGAACACCTGG + Intergenic
1201306067 Y:12551712-12551734 TCCAGGAGTTTGAGACCAGCTGG + Intergenic
1201768731 Y:17597046-17597068 GACAGGATTTTGAGATCAACCGG - Intergenic
1201832823 Y:18308939-18308961 GACAGGATTTTGAGATCAACCGG + Intergenic