ID: 1178873097

View in Genome Browser
Species Human (GRCh38)
Location 21:36392452-36392474
Sequence CGGGGTGGCGGCCGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4204
Summary {0: 2, 1: 205, 2: 1212, 3: 1143, 4: 1642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178873083_1178873097 13 Left 1178873083 21:36392416-36392438 CCCGTTCTCAGTGAGCTGTTGGG 0: 44
1: 1416
2: 531
3: 140
4: 182
Right 1178873097 21:36392452-36392474 CGGGGTGGCGGCCGGGTAGAGGG 0: 2
1: 205
2: 1212
3: 1143
4: 1642
1178873085_1178873097 12 Left 1178873085 21:36392417-36392439 CCGTTCTCAGTGAGCTGTTGGGT 0: 34
1: 1067
2: 689
3: 143
4: 220
Right 1178873097 21:36392452-36392474 CGGGGTGGCGGCCGGGTAGAGGG 0: 2
1: 205
2: 1212
3: 1143
4: 1642
1178873081_1178873097 28 Left 1178873081 21:36392401-36392423 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1178873097 21:36392452-36392474 CGGGGTGGCGGCCGGGTAGAGGG 0: 2
1: 205
2: 1212
3: 1143
4: 1642

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178873097 Original CRISPR CGGGGTGGCGGCCGGGTAGA GGG Intronic
Too many off-targets to display for this crispr