ID: 1178873848

View in Genome Browser
Species Human (GRCh38)
Location 21:36397295-36397317
Sequence ACTGCCTGCTGAGTGATGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178873844_1178873848 20 Left 1178873844 21:36397252-36397274 CCCCAGAGCCTGACACAGGGTTT 0: 1
1: 0
2: 2
3: 53
4: 463
Right 1178873848 21:36397295-36397317 ACTGCCTGCTGAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1178873845_1178873848 19 Left 1178873845 21:36397253-36397275 CCCAGAGCCTGACACAGGGTTTT 0: 1
1: 0
2: 2
3: 25
4: 303
Right 1178873848 21:36397295-36397317 ACTGCCTGCTGAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1178873847_1178873848 12 Left 1178873847 21:36397260-36397282 CCTGACACAGGGTTTTAGTACAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1178873848 21:36397295-36397317 ACTGCCTGCTGAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 108
1178873846_1178873848 18 Left 1178873846 21:36397254-36397276 CCAGAGCCTGACACAGGGTTTTA 0: 1
1: 0
2: 0
3: 12
4: 181
Right 1178873848 21:36397295-36397317 ACTGCCTGCTGAGTGATGCGTGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178873848 Original CRISPR ACTGCCTGCTGAGTGATGCG TGG Intronic