ID: 1178876592

View in Genome Browser
Species Human (GRCh38)
Location 21:36419003-36419025
Sequence GACACTGAAGTGACTTCACT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178876592_1178876593 6 Left 1178876592 21:36419003-36419025 CCAAGTGAAGTCACTTCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1178876593 21:36419032-36419054 TAAAACTGCCTGCAACCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 106
1178876592_1178876596 18 Left 1178876592 21:36419003-36419025 CCAAGTGAAGTCACTTCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1178876596 21:36419044-36419066 CAACCATCTGGGCAGTGTATTGG 0: 1
1: 0
2: 0
3: 11
4: 83
1178876592_1178876594 7 Left 1178876592 21:36419003-36419025 CCAAGTGAAGTCACTTCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1178876594 21:36419033-36419055 AAAACTGCCTGCAACCATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1178876592_1178876597 19 Left 1178876592 21:36419003-36419025 CCAAGTGAAGTCACTTCAGTGTC 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1178876597 21:36419045-36419067 AACCATCTGGGCAGTGTATTGGG 0: 1
1: 0
2: 0
3: 3
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178876592 Original CRISPR GACACTGAAGTGACTTCACT TGG (reversed) Exonic
901916369 1:12503588-12503610 AATACTGAGGTGACTTCTCTAGG + Intronic
905137477 1:35810652-35810674 GAGGATGAAGTGACTTCATTAGG + Intronic
905279457 1:36839818-36839840 GACTAGGAAGTGACTCCACTGGG + Intronic
909324109 1:74327144-74327166 GAAACTGGAGGAACTTCACTTGG + Intronic
909988124 1:82187575-82187597 GACACTGAACAGATCTCACTAGG - Intergenic
911722683 1:101208416-101208438 GAAACTGAAGTTTCTTCACCTGG + Intergenic
913126502 1:115795232-115795254 CACACTGGAGTTACTTCCCTCGG + Intergenic
917250892 1:173059739-173059761 GAGATTGGAGTGACTTTACTGGG + Intergenic
918430630 1:184456440-184456462 GACAGTGAAATTACTTAACTTGG - Intronic
919594956 1:199549690-199549712 GAAACTGATGTCACTTCAATTGG + Intergenic
920164408 1:204025549-204025571 GTCACTGAAGTGTTTTCAGTGGG - Intergenic
920364101 1:205439040-205439062 GCCACAGAAGTGACTTTTCTAGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1063821939 10:9846193-9846215 GACAATGAGGCCACTTCACTGGG - Intergenic
1064750053 10:18519372-18519394 GACACGGAAGCAAGTTCACTGGG - Intronic
1064842284 10:19607136-19607158 GACACTGATCTGACTTCAATAGG - Intronic
1069556000 10:69399024-69399046 GACAGAGAAGTGGCTTCACTTGG + Intronic
1072330298 10:94342218-94342240 GACAGTGAAGTGAGTTACCTAGG - Intronic
1074219203 10:111419865-111419887 AACACTGAAGTGAATTCCTTAGG - Intergenic
1074224358 10:111469218-111469240 CACTCTCAAGAGACTTCACTTGG + Intergenic
1074619945 10:115108269-115108291 GACAATGTAGCCACTTCACTAGG - Intronic
1076038435 10:127221550-127221572 GACACTGAAGGGATGTCACAAGG - Intronic
1079562744 11:21843238-21843260 GACACTGAACTGACTAAAATTGG - Intergenic
1080865517 11:36191135-36191157 GACACTGAAGGGCCATCACAGGG + Intronic
1081337678 11:41887024-41887046 GAAACTGAAGTCACTTCCTTCGG + Intergenic
1083655798 11:64229012-64229034 GTCACTAAATTGACTTCTCTTGG + Intronic
1086175879 11:83890407-83890429 GAAAATGAAGTGACTTATCTAGG - Intronic
1087324075 11:96699687-96699709 GACAATTAAGTGATGTCACTTGG + Intergenic
1087946185 11:104163535-104163557 GACACCAAAATGACTTCTCTAGG + Intronic
1088808311 11:113371596-113371618 AACATTGAAGATACTTCACTTGG - Intronic
1089829679 11:121315891-121315913 GCCAATGAAGTGACAACACTTGG - Intergenic
1092571522 12:9728936-9728958 GACACTGCATTGACTTTTCTAGG + Intronic
1093838577 12:23867668-23867690 GACACTGAAATGAATTAAGTGGG + Intronic
1097390219 12:59002849-59002871 GAAGCTGAAGTGACTTGTCTAGG + Intergenic
1098384061 12:69899923-69899945 GAAACTGAAGGAACTCCACTGGG - Intronic
1099157642 12:79199191-79199213 GACACTGAATTGAATTGAATTGG - Intronic
1101384611 12:104245749-104245771 TACACTGAAGTGAGTCCACAGGG - Intronic
1103002798 12:117398244-117398266 GACACTGAATTGATTTCCCCAGG - Intronic
1104322848 12:127768215-127768237 GACTCTCAAGTGTCTGCACTTGG - Intergenic
1109726405 13:66346960-66346982 TACAATGAAGTGACTTTATTGGG - Intronic
1110089735 13:71431109-71431131 GATACCGACGTGACTTCCCTGGG + Intergenic
1111866827 13:93779250-93779272 TACACTGGACTGAATTCACTGGG + Intronic
1112194888 13:97215306-97215328 GAAACTGTAGTGAATTCACTGGG + Intergenic
1112847576 13:103663151-103663173 GACACTGAACTGGATTCAGTGGG - Intergenic
1115835719 14:37399667-37399689 TACACTTAAGTCACATCACTAGG + Intronic
1116756275 14:48952600-48952622 GACACAGAAGTGACTCCTTTAGG - Intergenic
1118393845 14:65318958-65318980 GTCACTGAAGGGGCTTCATTTGG - Intergenic
1118583948 14:67333353-67333375 AACACTTAAATGACTTCATTGGG + Exonic
1120948682 14:90021312-90021334 AACAATGAAGTCACATCACTAGG + Intronic
1122286023 14:100653439-100653461 GACTCAGAGGTGTCTTCACTGGG - Intergenic
1123693424 15:22858587-22858609 GCCACTCTAGTGACTCCACTAGG + Exonic
1123915748 15:25024844-25024866 GACAGTGAAGGGACTGCATTTGG + Intergenic
1126116247 15:45210349-45210371 GAGACTCAAGTGACCTCACGGGG + Intergenic
1126897404 15:53273720-53273742 GACTCTAAAGTGACTCCAATAGG - Intergenic
1130425123 15:83789613-83789635 GACTCAGAAGGGCCTTCACTGGG - Intronic
1131149206 15:90036442-90036464 GCCACTGAAGGGACGTCCCTCGG - Intronic
1133790007 16:9002299-9002321 AACAGTGAAGTGACTTGCCTAGG - Intergenic
1135062046 16:19279347-19279369 GACAGGGAGGTCACTTCACTTGG + Intergenic
1135857246 16:26023066-26023088 TACACTGAAGTGAATACAGTTGG - Intronic
1136145598 16:28314660-28314682 GACACTGGAGTGACATGTCTGGG + Intronic
1136283512 16:29228323-29228345 GACACTGAAATGACATCACAGGG - Intergenic
1136531245 16:30870900-30870922 GACAGTGAAGTGACTTGCCCAGG - Intronic
1142087935 16:88194273-88194295 GACACTGAAATGACATCACGGGG - Intergenic
1147969649 17:44212549-44212571 GACACTGATGTGACCTCCCATGG - Intronic
1149313157 17:55415723-55415745 GACAGTGAAGATATTTCACTTGG + Intronic
1152870053 17:82748981-82749003 GGCACGGCAGTGACTTCTCTGGG + Intronic
1158159399 18:54463030-54463052 AGAACAGAAGTGACTTCACTAGG - Intergenic
1161862915 19:6811807-6811829 GACATTTCAGTGACTTCACATGG + Intronic
1162438341 19:10677032-10677054 GACCCGGAAGTGATTTCACCTGG - Intronic
925002560 2:417395-417417 CACACTGAAGTGAATTTCCTTGG - Intergenic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
925324224 2:3004905-3004927 GACAATGGAGTGTCTTCAGTGGG - Intergenic
931606511 2:64058326-64058348 TTCACTGGAGTCACTTCACTCGG + Intergenic
931836202 2:66100449-66100471 GATTCTCAAGTGACTACACTGGG - Intergenic
931982430 2:67708192-67708214 TACATTGAAGGAACTTCACTTGG + Intergenic
933088299 2:78085685-78085707 CACAATGTAGTGAATTCACTAGG - Intergenic
934035523 2:88085773-88085795 GAAACTGAGGTGTCTTCACAGGG - Intronic
935737202 2:106115679-106115701 GAAACTGAAGTGACTTCCTTGGG - Intronic
936508789 2:113129296-113129318 GAAACAGAAGTGCCTTCCCTGGG + Intronic
939695780 2:145322424-145322446 CACACTGAAGTGACTTTTCAAGG - Intergenic
939969020 2:148639758-148639780 GAGACTGAACTGCCTTCACAGGG + Intergenic
942590543 2:177541386-177541408 TACACTGAAGTGTGTTCCCTTGG + Exonic
944034202 2:195273830-195273852 GGGACTGAAGTCAATTCACTGGG + Intergenic
944527428 2:200634278-200634300 GACACAGCAGTGAGTTCAGTGGG - Intronic
1171952246 20:31430795-31430817 GACAGTGAGGTGATTTGACTGGG + Intergenic
1174971481 20:55280929-55280951 GACACAGAGGTGAGTTCTCTGGG + Intergenic
1176007542 20:62874686-62874708 GACCCTCAAGTGCCTTCCCTAGG + Intergenic
1178183130 21:30187225-30187247 TTTAGTGAAGTGACTTCACTTGG + Intergenic
1178876592 21:36419003-36419025 GACACTGAAGTGACTTCACTTGG - Exonic
1181215712 22:21328772-21328794 GACCCTGAAGTCCTTTCACTTGG + Intergenic
1183935874 22:41261902-41261924 GACAGTGAAGTGAGCTGACTAGG - Intronic
949655851 3:6218241-6218263 TACACTGAACTGTCTTCAGTAGG + Intergenic
950070731 3:10150104-10150126 GAAAGTTAACTGACTTCACTAGG + Exonic
950231848 3:11283025-11283047 GGCCCTGAAGTGCCTTCTCTGGG - Intronic
950267448 3:11585133-11585155 CACAGTCAAGAGACTTCACTGGG + Intronic
950991814 3:17447473-17447495 GAAACGGAAGAGACATCACTAGG + Intronic
951095608 3:18626096-18626118 GACACTTAAGGGTCTTCCCTCGG - Intergenic
952390051 3:32872333-32872355 CACACAGAAGTTACTCCACTCGG - Intronic
956322522 3:68013543-68013565 GGGACTGAAGAGGCTTCACTTGG + Intronic
956540141 3:70327583-70327605 GACTCTGAAGTTTCCTCACTTGG - Intergenic
956576715 3:70760262-70760284 GACAATGATGAGGCTTCACTGGG + Intergenic
958432365 3:94057600-94057622 GAAACAGAAGTGGCTTCACTCGG + Intronic
959583897 3:108008268-108008290 GACACTGAAGAGCCTTCAGATGG + Intergenic
960349334 3:116574201-116574223 GACAGTTAAGTGCCATCACTTGG - Intronic
962073476 3:132055938-132055960 CACACTGAAGGAAATTCACTTGG - Intronic
963451611 3:145489380-145489402 GCCACTGAAGTGTCTTAACAGGG - Intergenic
965914350 3:173824402-173824424 GACACTAAATTCACTTAACTAGG + Intronic
968750027 4:2383989-2384011 CACCCTGAAGTGTCTCCACTGGG + Intronic
969958872 4:10922260-10922282 TAACCTGAAGTGACCTCACTGGG + Intergenic
973195858 4:47439966-47439988 GAGACTTAAGAGACCTCACTTGG - Intergenic
973345565 4:49051263-49051285 GAACATGAAGTAACTTCACTGGG + Intronic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
980719436 4:136674952-136674974 GATAATGAAGTGACTAAACTTGG - Intergenic
983034936 4:162852127-162852149 AACACTGATGTAACTTCATTAGG - Intergenic
985482790 5:127595-127617 GCCACTGAAGTGACTTCCAGGGG - Intergenic
985873860 5:2580381-2580403 GACCCTGGAGAGCCTTCACTGGG - Intergenic
985963113 5:3318661-3318683 GACACTGAAATGATTTCTTTCGG - Intergenic
986009585 5:3700277-3700299 GTCTCTGAATTGACTTCTCTGGG - Intergenic
986569636 5:9151874-9151896 GACACTGGTGTGTCTTCACTGGG - Intronic
988825777 5:34932941-34932963 GACACAGAAGGGACTGCACAAGG + Intronic
992400481 5:76406765-76406787 AACACTTAAGTGACTACAGTGGG + Intronic
994149817 5:96434225-96434247 GAGACTGAACTCACTTCCCTAGG - Intergenic
995901123 5:117067415-117067437 GACACTGAAATCACCTCCCTGGG + Intergenic
998939501 5:147265748-147265770 GAAGCTGAAGTCACTTCCCTAGG - Intronic
1001293432 5:170482524-170482546 GTAACTGAAGTGATTTCTCTAGG + Intronic
1002329266 5:178430267-178430289 GACACACAGGTGACTTCACTGGG + Intronic
1006804059 6:36777207-36777229 GACAATGAGGGGACCTCACTCGG - Intronic
1008309889 6:49954276-49954298 GACACTGAAGTGGGCTGACTAGG + Intergenic
1011319244 6:86071900-86071922 GACCATGAAGTGGCTCCACTGGG - Intergenic
1011749689 6:90442719-90442741 GCATCTGAAGTGTCTTCACTCGG + Intergenic
1012086658 6:94835176-94835198 GACACTTACGTGACTCCTCTTGG - Intergenic
1012364918 6:98427096-98427118 GACACAGAAGTTTCTCCACTTGG + Intergenic
1013778271 6:113702917-113702939 GCCACTGAAGTGTCTAGACTGGG + Intergenic
1015604310 6:134939301-134939323 GTCACTGAAGTCAGCTCACTGGG + Exonic
1018443946 6:163837964-163837986 GACGCTGGCGTGACCTCACTGGG - Intergenic
1018973650 6:168546880-168546902 GACACTGACCTAACTTCACGTGG - Intronic
1019091182 6:169535864-169535886 TACTCTGAAGTGAATACACTGGG - Intronic
1021503455 7:21354875-21354897 GACTCGGGAGGGACTTCACTGGG + Intergenic
1022551049 7:31238928-31238950 AACACTGAAGTGACTTGCCCAGG + Intergenic
1029294816 7:99531697-99531719 GACACTGATGGGATTTCTCTCGG - Exonic
1030344733 7:108419921-108419943 GCCACTGAATACACTTCACTTGG + Intronic
1031603436 7:123741178-123741200 GAGACTGAAGTGAAGTAACTGGG + Intronic
1032351556 7:131168621-131168643 GAAACTGAAGTGACTTAAAAAGG + Intronic
1034312567 7:150101670-150101692 GACTCTCAAGTGACTTAACGTGG - Intergenic
1034794289 7:153998989-153999011 GACTCTCAAGTGACTTAACGTGG + Intronic
1039420320 8:37432537-37432559 GACACTGAAATGGCTTAATTTGG - Intergenic
1043039059 8:75237103-75237125 GATAATGATATGACTTCACTGGG + Intergenic
1044073170 8:87787285-87787307 GGCACCGAAGTGACTACATTTGG - Intergenic
1045462324 8:102436211-102436233 GACTGTAGAGTGACTTCACTTGG - Intergenic
1046557995 8:115800284-115800306 GGCAATGAAATGACTTTACTAGG + Intronic
1048708785 8:137184786-137184808 GACACGGAAGAGCATTCACTGGG - Intergenic
1048971922 8:139649953-139649975 GACACAGAAGCGTCTTCCCTTGG - Intronic
1049337607 8:142094711-142094733 GAAATTTAAGTGGCTTCACTGGG - Intergenic
1050568567 9:6913625-6913647 GTCACTGAAATGACTCCCCTTGG - Intronic
1059920041 9:119150122-119150144 GACACTGTAGGGATTTCACAAGG - Intergenic
1060224924 9:121784838-121784860 GCCACTGGGGTGCCTTCACTGGG + Exonic
1061500900 9:131001321-131001343 CACACTGAACTGACTTACCTGGG + Intergenic
1186639608 X:11441398-11441420 CACACTGAAGGGACATCACGGGG + Intronic
1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG + Intergenic
1187047866 X:15665760-15665782 CACTCTGAAGTACCTTCACTGGG + Intergenic
1187099265 X:16175618-16175640 GCCCATGAAGTGACTTAACTGGG - Intergenic
1187200024 X:17125919-17125941 GCCACTGCAAAGACTTCACTGGG - Intronic
1188192755 X:27192668-27192690 GACACAGAATTGAGTTCCCTGGG - Intergenic
1189438912 X:41017160-41017182 CACACTGAAGTGACCTCGCAGGG + Intergenic
1190795449 X:53736997-53737019 GACACAGCAGTGAGTTCCCTGGG + Intergenic
1192567067 X:72173807-72173829 GTCACTGAAGGGTCTTAACTGGG + Intergenic
1194821378 X:98510748-98510770 GACATTGAGGTGAGTTCCCTGGG - Intergenic
1196285868 X:113879635-113879657 GACACTTAAGTGGATTCCCTTGG - Intergenic
1197540758 X:127757000-127757022 GACACTGTAGTGAATACTCTAGG + Intergenic
1198244214 X:134813847-134813869 GACACTGACCTGTCTTCAGTGGG + Intronic
1198931561 X:141867091-141867113 AACACTGAATGGACCTCACTGGG + Intronic