ID: 1178877160

View in Genome Browser
Species Human (GRCh38)
Location 21:36422293-36422315
Sequence GCAGAATGACACCGGCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178877160_1178877165 -3 Left 1178877160 21:36422293-36422315 CCCCCATGCCGGTGTCATTCTGC No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877160_1178877166 1 Left 1178877160 21:36422293-36422315 CCCCCATGCCGGTGTCATTCTGC No data
Right 1178877166 21:36422317-36422339 TTCACGTGACAGTTACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178877160 Original CRISPR GCAGAATGACACCGGCATGG GGG (reversed) Intergenic
No off target data available for this crispr