ID: 1178877165

View in Genome Browser
Species Human (GRCh38)
Location 21:36422313-36422335
Sequence TGCTTTCACGTGACAGTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178877157_1178877165 27 Left 1178877157 21:36422263-36422285 CCAAGAGGCTGAGTGTTGGGGAA No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877160_1178877165 -3 Left 1178877160 21:36422293-36422315 CCCCCATGCCGGTGTCATTCTGC No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877156_1178877165 28 Left 1178877156 21:36422262-36422284 CCCAAGAGGCTGAGTGTTGGGGA No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877163_1178877165 -6 Left 1178877163 21:36422296-36422318 CCATGCCGGTGTCATTCTGCTTT No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877161_1178877165 -4 Left 1178877161 21:36422294-36422316 CCCCATGCCGGTGTCATTCTGCT No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877162_1178877165 -5 Left 1178877162 21:36422295-36422317 CCCATGCCGGTGTCATTCTGCTT No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data
1178877159_1178877165 -2 Left 1178877159 21:36422292-36422314 CCCCCCATGCCGGTGTCATTCTG No data
Right 1178877165 21:36422313-36422335 TGCTTTCACGTGACAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178877165 Original CRISPR TGCTTTCACGTGACAGTTAC AGG Intergenic
No off target data available for this crispr