ID: 1178879662

View in Genome Browser
Species Human (GRCh38)
Location 21:36439215-36439237
Sequence GAGTGGCATTTTAAATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178879662_1178879664 6 Left 1178879662 21:36439215-36439237 CCAATCAATTTAAAATGCCACTC No data
Right 1178879664 21:36439244-36439266 TTCAATGAATATCCACATATTGG No data
1178879662_1178879665 9 Left 1178879662 21:36439215-36439237 CCAATCAATTTAAAATGCCACTC No data
Right 1178879665 21:36439247-36439269 AATGAATATCCACATATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178879662 Original CRISPR GAGTGGCATTTTAAATTGAT TGG (reversed) Intergenic
No off target data available for this crispr