ID: 1178879990

View in Genome Browser
Species Human (GRCh38)
Location 21:36441850-36441872
Sequence GGGTGTGTCACCGGAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178879990_1178879992 -8 Left 1178879990 21:36441850-36441872 CCTTCTACTCCGGTGACACACCC No data
Right 1178879992 21:36441865-36441887 ACACACCCACTTTATCTTCCCGG No data
1178879990_1178879995 7 Left 1178879990 21:36441850-36441872 CCTTCTACTCCGGTGACACACCC No data
Right 1178879995 21:36441880-36441902 CTTCCCGGTACCTTCTATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178879990 Original CRISPR GGGTGTGTCACCGGAGTAGA AGG (reversed) Intergenic
No off target data available for this crispr