ID: 1178880005

View in Genome Browser
Species Human (GRCh38)
Location 21:36441930-36441952
Sequence ACTTGGGCTGAGAGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178880005_1178880012 5 Left 1178880005 21:36441930-36441952 CCTGTTTCCCTCTCAGCCCAAGT No data
Right 1178880012 21:36441958-36441980 GGGTGAAGCTAACTCCACTCTGG No data
1178880005_1178880015 28 Left 1178880005 21:36441930-36441952 CCTGTTTCCCTCTCAGCCCAAGT No data
Right 1178880015 21:36441981-36442003 CATTGACTCAGGCCTGCCCCAGG No data
1178880005_1178880013 17 Left 1178880005 21:36441930-36441952 CCTGTTTCCCTCTCAGCCCAAGT No data
Right 1178880013 21:36441970-36441992 CTCCACTCTGGCATTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178880005 Original CRISPR ACTTGGGCTGAGAGGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr