ID: 1178881842

View in Genome Browser
Species Human (GRCh38)
Location 21:36456084-36456106
Sequence CCACATGGAGTCTACCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178881833_1178881842 6 Left 1178881833 21:36456055-36456077 CCTCTCCACTGCCACCGCCTAGT No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881836_1178881842 -8 Left 1178881836 21:36456069-36456091 CCGCCTAGTCCAGACCCACATGG No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881827_1178881842 25 Left 1178881827 21:36456036-36456058 CCATCCCCATCTCTTCCCACCTC No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881835_1178881842 -5 Left 1178881835 21:36456066-36456088 CCACCGCCTAGTCCAGACCCACA No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881834_1178881842 1 Left 1178881834 21:36456060-36456082 CCACTGCCACCGCCTAGTCCAGA No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881826_1178881842 26 Left 1178881826 21:36456035-36456057 CCCATCCCCATCTCTTCCCACCT No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881829_1178881842 20 Left 1178881829 21:36456041-36456063 CCCATCTCTTCCCACCTCTCCAC No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881832_1178881842 9 Left 1178881832 21:36456052-36456074 CCACCTCTCCACTGCCACCGCCT No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881830_1178881842 19 Left 1178881830 21:36456042-36456064 CCATCTCTTCCCACCTCTCCACT No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881828_1178881842 21 Left 1178881828 21:36456040-36456062 CCCCATCTCTTCCCACCTCTCCA No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data
1178881831_1178881842 10 Left 1178881831 21:36456051-36456073 CCCACCTCTCCACTGCCACCGCC No data
Right 1178881842 21:36456084-36456106 CCACATGGAGTCTACCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178881842 Original CRISPR CCACATGGAGTCTACCTGCC TGG Intergenic
No off target data available for this crispr