ID: 1178881920

View in Genome Browser
Species Human (GRCh38)
Location 21:36456548-36456570
Sequence CCTCATACCTCCCTTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178881920_1178881930 28 Left 1178881920 21:36456548-36456570 CCTATTTAAAGGGAGGTATGAGG No data
Right 1178881930 21:36456599-36456621 CATCAGGCCTGGCAATCAGTGGG No data
1178881920_1178881929 27 Left 1178881920 21:36456548-36456570 CCTATTTAAAGGGAGGTATGAGG No data
Right 1178881929 21:36456598-36456620 GCATCAGGCCTGGCAATCAGTGG No data
1178881920_1178881924 -4 Left 1178881920 21:36456548-36456570 CCTATTTAAAGGGAGGTATGAGG No data
Right 1178881924 21:36456567-36456589 GAGGAGCACTGGGAGCTCCTAGG No data
1178881920_1178881928 17 Left 1178881920 21:36456548-36456570 CCTATTTAAAGGGAGGTATGAGG No data
Right 1178881928 21:36456588-36456610 GGCTGTGAAGGCATCAGGCCTGG No data
1178881920_1178881925 5 Left 1178881920 21:36456548-36456570 CCTATTTAAAGGGAGGTATGAGG No data
Right 1178881925 21:36456576-36456598 TGGGAGCTCCTAGGCTGTGAAGG No data
1178881920_1178881926 12 Left 1178881920 21:36456548-36456570 CCTATTTAAAGGGAGGTATGAGG No data
Right 1178881926 21:36456583-36456605 TCCTAGGCTGTGAAGGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178881920 Original CRISPR CCTCATACCTCCCTTTAAAT AGG (reversed) Intergenic
No off target data available for this crispr