ID: 1178882579

View in Genome Browser
Species Human (GRCh38)
Location 21:36461041-36461063
Sequence CTTTGTAGGCAGCTGGTGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178882567_1178882579 18 Left 1178882567 21:36461000-36461022 CCCGCTGTGCGTGGCCGAGGTCA 0: 1
1: 0
2: 0
3: 6
4: 139
Right 1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG 0: 1
1: 1
2: 1
3: 21
4: 231
1178882568_1178882579 17 Left 1178882568 21:36461001-36461023 CCGCTGTGCGTGGCCGAGGTCAC 0: 1
1: 0
2: 3
3: 107
4: 469
Right 1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG 0: 1
1: 1
2: 1
3: 21
4: 231
1178882573_1178882579 4 Left 1178882573 21:36461014-36461036 CCGAGGTCACTGAGGGGGCCCGA 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG 0: 1
1: 1
2: 1
3: 21
4: 231
1178882565_1178882579 24 Left 1178882565 21:36460994-36461016 CCTGTACCCGCTGTGCGTGGCCG 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG 0: 1
1: 1
2: 1
3: 21
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178882579 Original CRISPR CTTTGTAGGCAGCTGGTGGC TGG Exonic
900391282 1:2435061-2435083 CTTTGTCAGCAGCAGGAGGCAGG + Intronic
900764482 1:4494744-4494766 CTCTGTGGCCACCTGGTGGCTGG - Intergenic
900943192 1:5814402-5814424 CTTTGCAGGGGGCGGGTGGCAGG + Intergenic
902878062 1:19352924-19352946 CAGTGTAGGCGGCTGGTGGTAGG - Intronic
903366029 1:22805887-22805909 ATTTGTATGCAGCAGGGGGCAGG + Intronic
904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG + Intergenic
904772725 1:32889358-32889380 CCTCGTAGGCATGTGGTGGCAGG + Intronic
906530948 1:46523731-46523753 CTCTGCAGGCCCCTGGTGGCTGG - Intergenic
906561152 1:46757911-46757933 CTTTTGAGCCAGATGGTGGCAGG - Intronic
907572231 1:55493891-55493913 CTTTGTTGGCAGCTGGGGCAGGG + Intergenic
913009908 1:114672396-114672418 CTGTGTTGGCATCTAGTGGCTGG - Intergenic
916472423 1:165137274-165137296 CTCTGTGGGCAGGTGGTGGGAGG + Intergenic
916584403 1:166137927-166137949 CCCTGTAGGCAGCTGGTCTCAGG + Intronic
917184116 1:172333271-172333293 GTTTGTGGGAAGGTGGTGGCGGG + Intronic
917277940 1:173350845-173350867 CTTTGCAGGTAGCTGGGGCCAGG - Intergenic
917533325 1:175856188-175856210 CTTTGGAGGCAGGTGGAGGCAGG + Intergenic
918302714 1:183218762-183218784 ATTTGGAGCCAGCTGGTGGGAGG - Intronic
919882655 1:201911064-201911086 CTTTGCAGGGAGCTCCTGGCAGG - Intronic
920062350 1:203236190-203236212 CTTTGTGGGCATCTGGAGGGGGG + Intronic
921136994 1:212270171-212270193 CTTTGCAGTCATCTGCTGGCTGG + Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
921512960 1:216054669-216054691 CTTGGTTGGCAGCTGGGGGTGGG - Intronic
921929849 1:220746359-220746381 CTGTGCATGCAGCAGGTGGCGGG - Intergenic
922894251 1:229088267-229088289 CTGTGCAGGCGGCTGGCGGCAGG + Intergenic
922931755 1:229395590-229395612 CTTTTTCTGCAGCTGGGGGCTGG + Intergenic
923719161 1:236452381-236452403 CTTAGGAGGGAGCTGGTGGGAGG + Intronic
924486124 1:244486337-244486359 CCTTGTAGTCACCTGGTGGGTGG + Intronic
924486149 1:244486455-244486477 CCTTGTAGTCACCTGGTGGGTGG + Intronic
924844969 1:247757967-247757989 CTTTGTGTCCAGCTAGTGGCTGG - Exonic
924862521 1:247938934-247938956 CGTTGTAGGTCGCTGGTAGCTGG + Intronic
1063153167 10:3355125-3355147 CTCTGAAGGCAGGGGGTGGCTGG - Intergenic
1064081465 10:12311333-12311355 CACTGCAGGCAGCTGGAGGCAGG - Intergenic
1064629856 10:17298694-17298716 ATTTGTAGGCAACTGGTGAGTGG - Intergenic
1064986514 10:21216153-21216175 CTCTGTAGACAACTCGTGGCTGG - Intergenic
1066101186 10:32120071-32120093 CTCTGTTTGCAGCTGGTGCCAGG + Intergenic
1077671907 11:4165396-4165418 CTTACTAGGCAGGTGATGGCAGG - Intergenic
1079008750 11:16811417-16811439 CTATGCAGGCAGCTGCTGACTGG + Intronic
1079446376 11:20560119-20560141 ATTTGCAGTCAGCTGGTAGCTGG + Intergenic
1080630871 11:34074569-34074591 CTTTATAGGTAGGTGGAGGCAGG - Intronic
1082732738 11:56820078-56820100 GTCTGTATGCAGCTGGTGGTAGG - Intergenic
1083630493 11:64092649-64092671 CCTGGTACCCAGCTGGTGGCTGG - Intronic
1084614399 11:70226158-70226180 CTGTGTTGGCATTTGGTGGCTGG + Intergenic
1085315969 11:75545117-75545139 CTGTGGAGGGAGCTGGAGGCGGG + Intergenic
1087094797 11:94307954-94307976 CCTAGGAGGCAGCTGGGGGCTGG + Intergenic
1088628896 11:111754986-111755008 CTTTGTGGGCAGCAGCTGCCCGG + Exonic
1089908030 11:122065603-122065625 CTTGGTAGGGACCTGGTGGGAGG + Intergenic
1090194702 11:124804774-124804796 GGTTGTCGTCAGCTGGTGGCTGG - Intergenic
1091782882 12:3224998-3225020 CTGTGTGTGCAGCTGGTGGTGGG + Intronic
1093336338 12:17910005-17910027 CTCTGTAGGCAACTGGTGGTTGG + Intergenic
1096616304 12:52835138-52835160 CTTTGGAGGGAGCTGGAGGTGGG + Intergenic
1096924665 12:55130261-55130283 CTGTGTACTCAGTTGGTGGCTGG + Exonic
1097104681 12:56615029-56615051 CTTGGTAGGCAGCTTGGAGCTGG - Exonic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1100891588 12:99132005-99132027 GTTGGTAGGCAGCTGGGGGAGGG - Intronic
1102190330 12:110982929-110982951 GGTTGCAGTCAGCTGGTGGCAGG - Intergenic
1102623642 12:114216922-114216944 CTTTGTAGGAAACTGGAGGGTGG + Intergenic
1103127470 12:118436419-118436441 CTTTGCAGGGAAATGGTGGCAGG - Intergenic
1103327044 12:120128647-120128669 CTTTCAAGGCTGCTGGGGGCTGG + Intronic
1103358979 12:120342553-120342575 CTTTGTTCTCAGCTGGTGGGGGG + Exonic
1103510547 12:121470662-121470684 CTCTGTAGGCAACTGGAGCCTGG + Intronic
1103858514 12:123992317-123992339 TTTTCTAGCCAGCTGGTGGCAGG + Intronic
1108946515 13:56032526-56032548 CTTTGTAGCTAGCTGGTTTCAGG + Intergenic
1109715605 13:66218199-66218221 GGTTGTAGTCAGTTGGTGGCTGG + Intergenic
1112501188 13:99944678-99944700 CTCTGTAAGCAGGTGGAGGCAGG - Intergenic
1112596186 13:100809310-100809332 CTTTGCAGGCAGCTGTTTTCTGG + Intergenic
1113110300 13:106815647-106815669 CCATGTAGGCAGCCAGTGGCTGG - Intergenic
1113673709 13:112194249-112194271 CTTTGCAGGTAGCCGGCGGCGGG + Intergenic
1114284905 14:21232144-21232166 TTTGGTAGGCAGTGGGTGGCAGG - Intronic
1115577296 14:34724136-34724158 TTTTGTAGGCAGTTTGTGGAAGG - Intergenic
1120633053 14:86914723-86914745 CTTTGTAGGCAGCTTTTGTAAGG - Intronic
1120883772 14:89435631-89435653 CTTTTTACGGAGCTGTTGGCTGG - Intronic
1121468625 14:94133561-94133583 GGTAGAAGGCAGCTGGTGGCCGG - Intergenic
1122535068 14:102456204-102456226 CTTTGTTAGCTGCTGGTGGTGGG + Intronic
1122549869 14:102544152-102544174 CTTTGCTGGCATCTGGGGGCTGG - Intergenic
1124496331 15:30189690-30189712 CTGTGTAGCAAGCAGGTGGCAGG - Intergenic
1124747243 15:32348955-32348977 CTGTGTAGCAAGCAGGTGGCAGG + Intergenic
1124784612 15:32668164-32668186 ATTTTTTGGCAGCTGGTGGTGGG - Intronic
1126321549 15:47429606-47429628 CTTCCCAGGCAGTTGGTGGCTGG - Intronic
1129719817 15:77871919-77871941 CCCTGTAAGGAGCTGGTGGCAGG + Intergenic
1130108876 15:80949014-80949036 CTTCCCAGGCAGCTGCTGGCAGG - Exonic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1131514067 15:93065889-93065911 CTCTGTAGGCTGTTGCTGGCTGG + Intronic
1136462107 16:30417962-30417984 CTTTGGCGGCAGCTCGTGCCTGG + Exonic
1140461131 16:75140596-75140618 GTTTGTCAGCTGCTGGTGGCAGG - Intergenic
1144769032 17:17748922-17748944 CCTTTTTGGCACCTGGTGGCAGG + Intronic
1146713068 17:35059383-35059405 CTTTGGAGCTAGCTGTTGGCTGG - Intronic
1148247923 17:46047615-46047637 CTTTGTAGGGGGCGGGAGGCGGG + Intronic
1149114033 17:53070018-53070040 CATAATAGGTAGCTGGTGGCCGG - Intergenic
1149610971 17:57957443-57957465 CTCTGTAGGCGGCTGGTGTGAGG - Intergenic
1150200165 17:63347000-63347022 CTTTGTAAGAAACTGTTGGCTGG - Intronic
1151212146 17:72552695-72552717 GTTTTTATGCAGCTGGTGGGAGG - Intergenic
1151370679 17:73644690-73644712 CTTTGCAGGCAGCATCTGGCGGG + Intergenic
1151433753 17:74081612-74081634 TTTGGGAGGCAGCTGGAGGCAGG + Intergenic
1152412353 17:80133961-80133983 CTTGCTAGCCAGCTGGTGGCTGG - Intergenic
1153549150 18:6242517-6242539 GTTTGGAGGAAGCTGGTGACAGG - Intronic
1154031698 18:10758841-10758863 CTTTGTGGGCAGTTGCTGGGAGG - Intronic
1155021178 18:21898256-21898278 CTTTGAAAGGAGGTGGTGGCAGG - Intergenic
1155121941 18:22830036-22830058 CGTGGTAGTCAGATGGTGGCAGG - Intronic
1155136492 18:22999313-22999335 AGTTGTAGGCAGATGGTGGCTGG + Intronic
1155185437 18:23383205-23383227 CTCTGTGAGCAGCAGGTGGCTGG + Intronic
1157546509 18:48550334-48550356 CTTTGCAGGCAGCTGTGGGTTGG + Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1159887383 18:73922321-73922343 CTGTGTTGGGATCTGGTGGCAGG - Intergenic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1164544459 19:29148042-29148064 GTTTGGATGCAGCTGGTTGCAGG + Intergenic
1165007518 19:32818741-32818763 CGTTGTAGCCAGCAGGTGGAGGG + Intronic
1167742110 19:51329926-51329948 CTGGGTAGGCATCTGGTGTCAGG + Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925474384 2:4196781-4196803 CTTTCTGGGCAGCTGGTTACTGG + Intergenic
926893939 2:17663352-17663374 CTGTGTAGAAAGCTGTTGGCTGG - Intergenic
927105357 2:19819141-19819163 CCTAGTACGCAGCTGGTGTCTGG - Intergenic
928121149 2:28584381-28584403 CTATGAACGCAGCTGGTGTCAGG + Intronic
928428489 2:31199034-31199056 CTTTGTAGGCAGGTCCTGCCTGG + Intronic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
929810198 2:45183270-45183292 ATTTGTGGGCAGCTGGGGGATGG - Intergenic
930570861 2:53085137-53085159 CTTTGTAGACTGCTAGTGGCAGG + Intergenic
930608965 2:53520684-53520706 CTTTGCAGCCTGCTGGTGGGAGG - Intergenic
932944622 2:76213185-76213207 CTTTGTAGGCAGATGGGCTCTGG - Intergenic
934884913 2:98016083-98016105 CTCTGGAGGCAGCTGGTTGTGGG + Intergenic
935335528 2:102012302-102012324 CTCTGAAGCCAGCTGGTGGAAGG - Intronic
939027387 2:137030500-137030522 CCTTGTGGGCAGCTGGTACCTGG - Intronic
939511621 2:143113450-143113472 TTCTGTAGACAGCTGGGGGCAGG - Intronic
942584927 2:177465628-177465650 CCTTGTAGGGAGCTGATGCCTGG - Intronic
945278854 2:208016399-208016421 CTTTGGGGGGAGATGGTGGCAGG + Intronic
945293385 2:208147023-208147045 TTTTGTAGGCTTCTGGGGGCTGG + Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1169479163 20:5962047-5962069 AGTTGTAGTCAGATGGTGGCTGG + Intronic
1170332072 20:15224113-15224135 GGTTGTAGTCAACTGGTGGCTGG - Intronic
1170718230 20:18850831-18850853 CTGTGTGGGCAGTTGGGGGCTGG - Intergenic
1172274267 20:33671251-33671273 CTCTGTAGGCAGCAGCAGGCTGG + Intronic
1173353691 20:42267698-42267720 CTTTGTTGGGGGCCGGTGGCAGG - Intronic
1174849551 20:53979327-53979349 CTGGGTAGGGTGCTGGTGGCTGG + Intronic
1175148927 20:56917648-56917670 CTTTGCAGGCTACAGGTGGCTGG - Intergenic
1175310236 20:58006764-58006786 CTCTGGTGGCATCTGGTGGCAGG - Intergenic
1177282197 21:18995061-18995083 CTTTCTATGCAGCAAGTGGCAGG - Intergenic
1178593464 21:33931707-33931729 TTTTGGAGGCACCTGGTTGCAGG + Intergenic
1178811086 21:35882100-35882122 CTTAGTAGGAAGTTGGTGGGAGG + Intronic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1184164469 22:42719739-42719761 GTCTTTGGGCAGCTGGTGGCGGG + Intronic
1184959424 22:47918199-47918221 ATTTGTTGCCAGCTGTTGGCTGG - Intergenic
1185114539 22:48924328-48924350 CTGTGTAAGCAACTGGGGGCCGG + Intergenic
1185169087 22:49281909-49281931 CTTTGTAGACACCTGGAGGGAGG + Intergenic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
950070604 3:10149061-10149083 TTTTGCTGGCAGCTGGGGGCTGG + Intronic
950451538 3:13068226-13068248 CTTTGGTGGAAGATGGTGGCAGG + Intronic
952341288 3:32449680-32449702 CTTTGGAGAGAGCTGATGGCTGG - Intronic
952813240 3:37423797-37423819 AGTGGTAGCCAGCTGGTGGCTGG - Intronic
952860691 3:37810043-37810065 CTTTGAAGACAGCGGTTGGCGGG + Intronic
953078013 3:39588503-39588525 CTTTGATGTCAGTTGGTGGCTGG - Intergenic
953587157 3:44213097-44213119 CTTTGTATTCAGTTGGTTGCTGG - Intergenic
955006419 3:54972905-54972927 CTTCTTAGGCACCTGGTGCCTGG + Intronic
956430696 3:69183298-69183320 ATTTTTAGGTAGCTGGTGGTGGG - Intronic
960686898 3:120303804-120303826 CTTTGTAGCCAGCTGGTCAGAGG - Intergenic
961448866 3:126993431-126993453 CTTTGTGGGCAGCTGCTGGATGG + Intronic
962014177 3:131423461-131423483 GTTTGTATTCAGATGGTGGCTGG - Intergenic
967186685 3:186950113-186950135 CTGTGGAGGGAGCTGGAGGCAGG + Intronic
968262546 3:197336799-197336821 CTTCCTAGTCAGCTGGTGGAGGG + Intergenic
968734717 4:2289504-2289526 CTTTGATGACAGCAGGTGGCAGG - Intronic
969520549 4:7675545-7675567 CTTTCTAGGCATCCAGTGGCTGG + Intronic
972552187 4:40144168-40144190 CCATGTGGGCAGCTGGAGGCTGG - Intronic
975458506 4:74622522-74622544 CTGTGTAGGGAGCTGGGGGTTGG - Intergenic
978369906 4:108019743-108019765 CATCCTAGGCAACTGGTGGCAGG - Intronic
981052818 4:140327951-140327973 CGTTGGAGGCACCTGCTGGCAGG - Intronic
981236550 4:142422703-142422725 CTTGGGAGGCTGCTGGTGGAAGG + Intronic
983361975 4:166737974-166737996 CGATGAAGGCAGATGGTGGCAGG - Intronic
983718913 4:170821225-170821247 CTTTGTAGGAATCTGGTTGCTGG + Intergenic
987025832 5:13925699-13925721 CTTGGTAGGAACCTGGTGGGAGG - Intronic
988892995 5:35639443-35639465 ATTTTTAGGCAACTGGTGCCAGG + Intronic
990012604 5:51018621-51018643 CTTTGTAGGCAGGTGGGTACAGG + Intergenic
991001845 5:61790934-61790956 TGTTGTGGGCAGATGGTGGCTGG - Intergenic
991936588 5:71808046-71808068 CTTTGTTAGTGGCTGGTGGCAGG + Intergenic
992212362 5:74493305-74493327 CTTATTAGAGAGCTGGTGGCTGG - Intergenic
996248172 5:121291931-121291953 CCTTGCAGGCAGCTGGTGGGAGG + Intergenic
996655737 5:125933743-125933765 CTTTCTATGCAGCAAGTGGCAGG + Intergenic
999844321 5:155461832-155461854 CATTGTAAGCTGCTGGAGGCTGG + Intergenic
1001860588 5:175051353-175051375 CATGGTAGGGAGCTGGTGGGAGG + Intergenic
1005520348 6:26595879-26595901 CTTTGCAGTCAGCTTGTCGCTGG + Intergenic
1006276296 6:33007674-33007696 CTTTGTAGCCATCTGTGGGCAGG + Intronic
1006444918 6:34074786-34074808 GTTTGGAGGCAGATGGTGGCAGG + Intronic
1007472414 6:42099431-42099453 CTGGGTAGGCAGGTGGGGGCAGG + Intergenic
1010727867 6:79355759-79355781 CTCTGAAGGCAGGTGGTGCCTGG + Intergenic
1011041763 6:83037161-83037183 ATTTGGAGGCAGCAGGTGACAGG - Intronic
1011256401 6:85426240-85426262 TTTTGTAGACAGCATGTGGCTGG - Intergenic
1011770383 6:90669324-90669346 ATTTGTAGGAAGCTAGTAGCTGG - Intergenic
1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG + Intronic
1013770114 6:113619300-113619322 CGTTGCAGTAAGCTGGTGGCTGG + Intergenic
1014482079 6:121951200-121951222 ATTTCCAGGCAGCTGGTGACAGG + Intergenic
1014968877 6:127790841-127790863 CCTTGCAGGGAGCTGGTGCCTGG - Intronic
1015009117 6:128322240-128322262 CATTGTAGGCAGCTGAAGTCTGG + Exonic
1017202747 6:151773548-151773570 GTTTGAAGGCAGCTGCTGGCAGG + Intronic
1019648636 7:2144397-2144419 CTTTGGAGAGGGCTGGTGGCGGG - Intronic
1019696172 7:2447261-2447283 CTTTGGAGGAAGCCAGTGGCCGG - Intergenic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1024559916 7:50634619-50634641 TCTTGTAGGCAGCAGATGGCTGG - Intronic
1025636456 7:63324143-63324165 CTTTATTGGCAGCTTGTGGTTGG + Intergenic
1025646240 7:63423959-63423981 CTTTATTGGCAGCTTGTGGTTGG - Intergenic
1025724849 7:64046938-64046960 CTTTATTGGCAGCTTGTGGTTGG + Intronic
1030754514 7:113271819-113271841 TCTTGTAGGCAGCAGGTGGATGG - Intergenic
1031936651 7:127742098-127742120 CTTGATGGGCAGCTGGTAGCTGG + Intronic
1033038051 7:137893470-137893492 CTTTGTGTGCAGCTGGGGGTGGG + Intronic
1033342366 7:140502096-140502118 GCTTGCAGCCAGCTGGTGGCTGG + Intergenic
1033532554 7:142279845-142279867 CTTTGCAGGCAGCTGGTGGCTGG - Intergenic
1034502826 7:151461937-151461959 CTTTGTTGGGAGCTGGTGTCAGG + Intergenic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1034885921 7:154798903-154798925 CTTCGCTGGCAGCAGGTGGCAGG - Intronic
1037588450 8:20294363-20294385 CTGTGCAGCCGGCTGGTGGCTGG - Intronic
1039455041 8:37700454-37700476 CTTTGGCGCCACCTGGTGGCAGG + Intergenic
1039993158 8:42507075-42507097 CTTTGCAGTCAGCTGGCAGCTGG - Intronic
1040440847 8:47440415-47440437 CTTTGGGAGGAGCTGGTGGCTGG - Exonic
1041439825 8:57882589-57882611 CTCTGTAGTCAGCTGGAGTCTGG - Intergenic
1044569127 8:93698725-93698747 CTTTCTGGTCAGCTGGCGGCTGG - Intronic
1044707534 8:95023612-95023634 AAGTGTAGGCAGCTGCTGGCTGG + Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045357464 8:101402443-101402465 CAGTGTAGGCAGCTAGTGGAGGG + Intergenic
1046038054 8:108867856-108867878 CTTTTTAGGAAGCTTGTGGCTGG - Intergenic
1047151217 8:122265284-122265306 CTTGGGAGGGAGCTGGTGGGAGG - Intergenic
1047943052 8:129845280-129845302 CTTTGAAGCCAGCAAGTGGCAGG - Intronic
1048185378 8:132235521-132235543 CTTGGTGGTCAGCTAGTGGCTGG - Intronic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1053275833 9:36782679-36782701 CTCTGGAGGCAGCTGGTAGCAGG - Intergenic
1053291519 9:36882544-36882566 CTTTGAAGGCAGGTGGTGGCAGG - Intronic
1053550333 9:39072343-39072365 CTTGGTAGGCAGTTGGTATCTGG + Intergenic
1053814443 9:41892446-41892468 CTTGGTAGGCAGTTGGTATCTGG + Intronic
1054464611 9:65486156-65486178 CTTTGTAGGCACCTGCGGGGCGG - Intergenic
1054616153 9:67294994-67295016 CTTGGTAGGCAGTTGGTATCTGG - Intergenic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1057221728 9:93261137-93261159 CTCTGTTGGCAGCCAGTGGCAGG - Intronic
1057788229 9:98104659-98104681 CTTTGAAGAGAGCTGGTGGCTGG + Intronic
1059468394 9:114484240-114484262 CTTTGTAGGAAGCTGCCTGCAGG + Intronic
1059925884 9:119208721-119208743 CTCTCTAGGCAGCTGGTGGTTGG + Exonic
1060937120 9:127522170-127522192 CTTTGTGGGCAGCTGGGCCCAGG + Intronic
1062231654 9:135485307-135485329 CTTTGTAGGCGGCTCTTGGTGGG - Exonic
1062551582 9:137089910-137089932 CTTGGTGGGCAGGTGGTGCCAGG + Intronic
1062558299 9:137127270-137127292 CTTGGTGGGCAGGTGGTGCCGGG - Intergenic
1185579175 X:1197427-1197449 CTTTGGAGGCTTCTGGTTGCTGG + Intronic
1186182534 X:6986968-6986990 CTTGGCAGGCAGCTGGAGGGAGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1187487532 X:19718918-19718940 CTGTGTAGGCTGGTGGTGTCTGG - Intronic
1189731914 X:44029796-44029818 TTCTGTATGCAGCTGGCGGCAGG + Intergenic
1192196590 X:69032872-69032894 CTCTGGAGGCAGCTTGTGGCCGG + Intergenic
1192617679 X:72645014-72645036 TTTTTTAGGCAGCAGGTAGCGGG + Intronic
1193236579 X:79114298-79114320 CTGTGAAGGCAGCTGGGAGCAGG - Intergenic
1193664048 X:84294084-84294106 CTATGCAGCCAGCTGGAGGCTGG - Intergenic
1195063587 X:101219563-101219585 CTTTGGAGCCAGCAGCTGGCAGG - Intergenic
1195065773 X:101236958-101236980 CATGGTAGGAAGCTGGAGGCTGG - Intronic
1196048245 X:111278680-111278702 CTTTGCTAGCAGGTGGTGGCTGG + Intergenic
1196163461 X:112512102-112512124 AGATGTAGGCAGTTGGTGGCGGG - Intergenic
1198312034 X:135433597-135433619 CTCTGTAGGCAGGTGGGGGTCGG + Intergenic
1201149977 Y:11090345-11090367 CCTTGTAGACATCTGGTGCCAGG + Intergenic
1201150003 Y:11090473-11090495 CCTTGTAGACATCTGGTGCCAGG + Intergenic
1202332716 Y:23771211-23771233 CTTGGGAGGCAGCTAGTGACTGG + Intergenic
1202538053 Y:25898852-25898874 CTTGGGAGGCAGCTAGTGACTGG - Intergenic