ID: 1178884736

View in Genome Browser
Species Human (GRCh38)
Location 21:36476242-36476264
Sequence CACTTTTTCTAGATGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178884736_1178884746 17 Left 1178884736 21:36476242-36476264 CCTTCTGCCATCTAGAAAAAGTG 0: 1
1: 0
2: 4
3: 34
4: 275
Right 1178884746 21:36476282-36476304 TTATTTATCTTGCTGCCTTCTGG 0: 1
1: 0
2: 6
3: 46
4: 513
1178884736_1178884745 -10 Left 1178884736 21:36476242-36476264 CCTTCTGCCATCTAGAAAAAGTG 0: 1
1: 0
2: 4
3: 34
4: 275
Right 1178884745 21:36476255-36476277 AGAAAAAGTGGTTGGGGGGGTGG 0: 1
1: 0
2: 8
3: 117
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178884736 Original CRISPR CACTTTTTCTAGATGGCAGA AGG (reversed) Intronic
900372054 1:2336538-2336560 CAATCTTTCTAGAAGGCAGGCGG - Exonic
900653186 1:3741217-3741239 CACGTTTTCTGCCTGGCAGATGG + Intergenic
905078984 1:35300115-35300137 CTCTTTTTCTATGTGGCAGATGG - Intronic
910011929 1:82475071-82475093 CACTCTTTTTGGATTGCAGATGG + Intergenic
911877954 1:103193328-103193350 CACTGTTTCTAGATAGCCAATGG + Intergenic
916769219 1:167891823-167891845 CACATTTTCTAGATTAAAGAAGG + Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
918613883 1:186522772-186522794 CACTTTTTCCACAAGGCAGCAGG - Intergenic
918792471 1:188846901-188846923 CCTTTGTTCTAGCTGGCAGAGGG - Intergenic
920290493 1:204919631-204919653 CACTTTTTTTGGGGGGCAGATGG + Intronic
920670092 1:207997417-207997439 CCCTTTTTCTTGAAGACAGATGG + Intergenic
921129226 1:212205349-212205371 CATCCTTTCTAGATGGAAGATGG - Intergenic
921166587 1:212512416-212512438 CACATTTTCCAAATGGCTGATGG - Intergenic
922371908 1:224919792-224919814 AACACTTTCTACATGGCAGATGG - Intronic
923943580 1:238857026-238857048 CACCTTTGCTACAGGGCAGATGG + Intergenic
1062781426 10:213275-213297 CACCTTTTCTAGTTTGCACATGG + Intronic
1064476562 10:15696305-15696327 CAAGTTTTCTAAGTGGCAGAAGG + Intronic
1064557512 10:16562093-16562115 CACTTTTACTAAATGGGAAACGG - Intergenic
1065701485 10:28430178-28430200 CCCTTTTTCTGCCTGGCAGATGG - Intergenic
1066030783 10:31421438-31421460 GAATTTTGCTAGATAGCAGATGG - Intronic
1066259983 10:33720035-33720057 CACCTTTTCTGTGTGGCAGATGG + Intergenic
1067688432 10:48482265-48482287 TACTTTTTGTATATGGGAGAAGG + Intronic
1069863617 10:71486620-71486642 CTCATTTTCTAGATGGGAAACGG + Intronic
1069912277 10:71766877-71766899 CATTTTTTCTAAATAGCTGAAGG - Intronic
1070499226 10:77054762-77054784 CCATTCTTCAAGATGGCAGATGG + Intronic
1071042479 10:81330289-81330311 CACTCTTTTAAGAAGGCAGAGGG + Intergenic
1073669210 10:105568685-105568707 CCCTATTTCTATATTGCAGATGG + Intergenic
1073778273 10:106809838-106809860 TACTGTTTGTGGATGGCAGAAGG + Intronic
1073839946 10:107486911-107486933 CACTTGTTCTACAAAGCAGAGGG + Intergenic
1074018585 10:109561144-109561166 CACTCTTTTTAGATGGCTAATGG - Intergenic
1074497101 10:113989290-113989312 CACTTTTTCAAAATGTTAGAAGG - Intergenic
1078078530 11:8184549-8184571 CAATTTTTTTAAATGGCAAAGGG - Intergenic
1078387849 11:10908622-10908644 CACCTTTTCTGTGTGGCAGATGG + Intergenic
1078632923 11:13019917-13019939 TAATTTTTGTAGATGGTAGAAGG + Intergenic
1079352773 11:19706137-19706159 CACTTTCTGTAGGTGGGAGAAGG - Intronic
1081548631 11:44091850-44091872 CTCTTTTTCTGGTTTGCAGAGGG - Intergenic
1085483740 11:76843986-76844008 CCCTTTTTCTACATGGTAGATGG + Intergenic
1085814644 11:79724726-79724748 CACCTTCACTAAATGGCAGACGG + Intergenic
1086000774 11:81983664-81983686 CACTGCTTCTAGTTTGCAGATGG + Intergenic
1086132366 11:83414174-83414196 TAATTTTTGTAGATGGCATAAGG + Intergenic
1087077020 11:94134789-94134811 CTCTTTTCCTAGTTTGCAGATGG - Intronic
1087908868 11:103729795-103729817 CTCTTTTTCTGGCTTGCAGATGG + Intergenic
1088169170 11:106976239-106976261 CTTTTTTTTTGGATGGCAGAAGG - Intronic
1088888702 11:114028172-114028194 CACTATTTCCAGTTGGGAGAGGG + Intergenic
1090643369 11:128747759-128747781 GGCTTTTTCTAGATGGCAGTGGG - Intronic
1092813146 12:12289918-12289940 CACTCTTTCTAGTTTGTAGATGG - Intergenic
1094419316 12:30254235-30254257 CACATTTCTTAGAAGGCAGATGG - Intergenic
1095486659 12:42692071-42692093 CACGTTTTCTGCATGGCAGATGG + Intergenic
1098135513 12:67397663-67397685 CACTTTTTCTGCCTGGCAGATGG - Intergenic
1098169524 12:67732621-67732643 AACTTTTTCTATAGAGCAGATGG + Intergenic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1102856726 12:116300511-116300533 CACTTGGTCTAGGAGGCAGATGG + Intergenic
1103542340 12:121674819-121674841 CACTTTTTCTACTTGGCACAAGG + Intergenic
1103721932 12:122979841-122979863 AGCATCTTCTAGATGGCAGAGGG + Exonic
1105358859 13:19687540-19687562 CCCACTTTCTAGATGGCACAGGG + Intronic
1105556337 13:21449601-21449623 GACTATTTCTTGATGGAAGAAGG + Intronic
1105923391 13:24985192-24985214 CATTTTTTCTAGATGGCTGTGGG - Intergenic
1106366058 13:29082180-29082202 CCCTCTTTCTAGCTTGCAGATGG - Intronic
1109188675 13:59299983-59300005 CCCTTTTATTAGCTGGCAGACGG + Intergenic
1110309474 13:74031630-74031652 CACTGCTTGTAGATGGAAGAAGG - Intronic
1110707983 13:78616918-78616940 CACTTTCTGCAGATGGCAAAGGG - Exonic
1110902058 13:80836371-80836393 CACTTTCTTTACATGGCAGCAGG + Intergenic
1111446962 13:88359035-88359057 CACTTTTTCCAGATCTTAGAAGG - Intergenic
1111567999 13:90041956-90041978 AACTCTTTCTAGCTTGCAGATGG - Intergenic
1111908851 13:94287567-94287589 CCCTTTTTCTCCATGGGAGATGG + Intronic
1112552693 13:100436463-100436485 CACCTTTTCTGTGTGGCAGATGG - Intronic
1115076983 14:29404382-29404404 CACATTTTCTAGCTTTCAGAAGG - Intergenic
1116044689 14:39730285-39730307 CAATTTTTCTAGATGAAAGCAGG - Intergenic
1116765196 14:49062012-49062034 CAATTTTTCTTGATGAAAGATGG + Intergenic
1118100646 14:62597641-62597663 CTCTTTTTCTAAATGCCAAAAGG - Intergenic
1118294911 14:64559752-64559774 AACTTTATTTAGATGGCACAGGG + Intronic
1118732977 14:68682331-68682353 CAGTTTTTCTAGAGATCAGATGG - Intronic
1120340167 14:83209136-83209158 AGCATTTTTTAGATGGCAGAAGG + Intergenic
1120900686 14:89573057-89573079 CCCTTTTCCTGTATGGCAGAAGG - Intronic
1121555973 14:94837523-94837545 CAGTATTTCTAGAATGCAGATGG - Intergenic
1122739399 14:103862804-103862826 CACCTTTTCTTCATGGCAGATGG - Intergenic
1123907572 15:24935762-24935784 CACTTTTTCCAGAAGCAAGAAGG - Intronic
1124547175 15:30640944-30640966 GACTTTTTCCAAATGGCAAATGG + Intronic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1124780773 15:32630904-32630926 GACTTTTTCCAAATGGCAAATGG + Intronic
1126330109 15:47522728-47522750 CCCTTCTTCATGATGGCAGATGG + Intronic
1127595952 15:60482265-60482287 CTCTGTTTCTAGCTTGCAGATGG - Intergenic
1129979750 15:79857538-79857560 AATTTGTTCTAGATGGCACAAGG - Intronic
1130213418 15:81946667-81946689 CACCTTTTCTGCAGGGCAGATGG + Intergenic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1131531352 15:93195377-93195399 CTCTCTTCCTAGATTGCAGATGG - Intergenic
1131911598 15:97211161-97211183 CACATATTTTAGATGGCATAGGG + Intergenic
1131951267 15:97683956-97683978 AACTTTTTCTGCATGGCAGCTGG - Intergenic
1133868734 16:9668479-9668501 CACTCTTTCTAAATGTCAGCGGG - Intronic
1135006693 16:18830478-18830500 CACTTCTTCTTAATGCCAGAAGG - Intronic
1137850967 16:51742190-51742212 CATGTTTTCTGCATGGCAGATGG + Intergenic
1138273534 16:55713488-55713510 AACTTTTTCCAGAAGGCAAAAGG + Intergenic
1138903357 16:61301227-61301249 CACTATTTCTTGCTGGGAGATGG - Intergenic
1138930606 16:61651324-61651346 CACTTTTTCTTGAGGTCAAAGGG - Exonic
1139034966 16:62933731-62933753 CACTTTTTATAAATGACAGAAGG + Intergenic
1139523766 16:67500519-67500541 CACTTTATCTTGGTGGCAGCAGG - Intergenic
1141232716 16:82184765-82184787 CATTTTTTCTATATGGGAGATGG + Intergenic
1141764324 16:86048544-86048566 CACTCTCTCTAGCTGGCAGGAGG + Intergenic
1146478280 17:33180708-33180730 CACGATCTCTAGATGTCAGAGGG - Intronic
1146956914 17:36941263-36941285 CACTTTGTGCAGAAGGCAGAGGG - Intronic
1148155687 17:45424252-45424274 CTCTGTTTCCAGATTGCAGAAGG - Intronic
1148178968 17:45589964-45589986 CTCTTTTCCTAGCTTGCAGATGG + Intergenic
1148270189 17:46256482-46256504 CTCTTTTCCTAGCTTGCAGATGG - Intergenic
1148994311 17:51695733-51695755 CACTTTTTCCAGTTGTCAAAGGG + Intronic
1150387370 17:64772908-64772930 CTCTGTTTCCAGATTGCAGAAGG - Intergenic
1150878213 17:68993709-68993731 CATCTTTTCTAGATGGTGGATGG - Intronic
1151256131 17:72878194-72878216 CACATTTTCTTAATGGCACAAGG + Intronic
1152004823 17:77673643-77673665 CACGTTGTCCAGCTGGCAGATGG + Intergenic
1153297266 18:3559349-3559371 CATTTTTTCTAAATGGGAAAAGG + Intronic
1153800662 18:8665560-8665582 CACCTTTTCTGCAAGGCAGATGG - Intergenic
1156010286 18:32489355-32489377 CAAGTTTTCTAGGTGGCAGGAGG - Intergenic
1156416998 18:36905765-36905787 CACATTATCATGATGGCAGATGG + Intronic
1156849336 18:41708101-41708123 CCCTTTTTCTGCGTGGCAGATGG - Intergenic
1158106252 18:53888209-53888231 CACTTATACTAGATAACAGATGG - Intergenic
1158654883 18:59321561-59321583 AACTTTTTCTACGTGGCAGATGG + Intergenic
1160734163 19:654256-654278 CACTTTTTCTATATTGTAGATGG - Intronic
1160807385 19:998452-998474 CACTTGTTCCACATGGCAGCTGG + Intergenic
1161513442 19:4683922-4683944 CCCATTTTCTAGAGGGCACAAGG + Intronic
1165053938 19:33161674-33161696 CACTGTGCCTAGATGACAGAGGG - Intronic
1165099456 19:33430231-33430253 CAACTTTTCTAGATGGCACTGGG + Intronic
1165183802 19:33998782-33998804 GACTTTTACTAGATGACAGAGGG - Intergenic
1165255407 19:34574929-34574951 CCCTTTTTCTGTGTGGCAGATGG - Intergenic
1168521524 19:57054731-57054753 AACTTTTTCCAGAGGGCAGCAGG - Intergenic
925372495 2:3356922-3356944 CACCTTTTCTGCATGGCAGTAGG + Intronic
927365342 2:22288986-22289008 CACTTTTTCTAGTGGGCTCAAGG - Intergenic
930023697 2:47016847-47016869 CAATTTTTCCAGATCGCAGGTGG + Intronic
931193666 2:60029261-60029283 CTCTTGTTTTTGATGGCAGAAGG - Intergenic
931669323 2:64632546-64632568 CACTTTCTCTGGATGACAGAAGG - Exonic
931812888 2:65872310-65872332 CACTATTTGAAGACGGCAGATGG + Intergenic
933838422 2:86264691-86264713 CACTTTTGCCAGAAGCCAGAAGG - Intronic
934074190 2:88413763-88413785 CATTTTTTCTAAGTGCCAGAGGG + Intergenic
936400195 2:112158930-112158952 GATGTCTTCTAGATGGCAGATGG - Intronic
937019610 2:118638502-118638524 CACCTTTTCTGCATGGCAGATGG + Intergenic
937053804 2:118914201-118914223 CACTATTTCTAGATCTCTGAGGG - Intergenic
937146034 2:119645442-119645464 CACTTTTTGTATAAGACAGAAGG - Intronic
937650226 2:124311332-124311354 CTCTCTTTCTAGCTTGCAGACGG + Intronic
938368244 2:130752356-130752378 TAATTTTTGTATATGGCAGAAGG - Intergenic
939455932 2:142435637-142435659 CACTTTTTCTGGTTTGCAGATGG + Intergenic
940431767 2:153599922-153599944 CACATTATCAAGATGGCTGATGG + Intergenic
941925915 2:170894544-170894566 CACTTTTTCTAAATGACAGCTGG - Intergenic
943019849 2:182560017-182560039 CACATTTTCTTGGTGGCAGAGGG + Intergenic
944148849 2:196536126-196536148 CAATTTTTCTAAATGGCCAAGGG + Intronic
944447629 2:199807252-199807274 CAGATTTTCTAAAAGGCAGAAGG + Intronic
944512304 2:200476763-200476785 TACTTTTTCATGAAGGCAGAGGG + Intronic
946345265 2:219104595-219104617 AACTTTTACTACATGACAGAAGG + Intronic
947073628 2:226318312-226318334 CACTTTATCTAGAATGCAGGAGG - Intergenic
947314802 2:228844625-228844647 CATTTTTTCTAGAGGTGAGAAGG - Intergenic
948791354 2:240378789-240378811 CACCTTTTCTTAATGCCAGAGGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172560139 20:35880668-35880690 TACTTTTTCTAGATGGGATGCGG + Intronic
1172732132 20:37096782-37096804 GACCTTTTCTGCATGGCAGATGG + Intergenic
1173561832 20:44011608-44011630 CAGTTTTACCAGATGGCTGAGGG + Intronic
1174547860 20:51339454-51339476 CACTCTTTCTAGATGGCACAAGG + Intergenic
1175569322 20:60007022-60007044 CTCTCTTGCTAGCTGGCAGATGG + Intronic
1176514169 21:7771033-7771055 GATTTTTTCCAGGTGGCAGAAGG + Intronic
1177026451 21:15926621-15926643 CACCTTATGTGGATGGCAGAAGG + Intergenic
1177673268 21:24262129-24262151 AACTTTTTCTAGATTTTAGAAGG + Intergenic
1178039797 21:28627794-28627816 CTCTTTTTCTGCCTGGCAGATGG + Intergenic
1178189400 21:30263335-30263357 CTCTTTTTCTTGGTGGCATAAGG + Intergenic
1178648282 21:34401557-34401579 GATTTTTTCCAGGTGGCAGAAGG + Intronic
1178884736 21:36476242-36476264 CACTTTTTCTAGATGGCAGAAGG - Intronic
1179326358 21:40349984-40350006 CATCTCTTGTAGATGGCAGATGG + Intronic
1181181788 22:21073655-21073677 CACTTGTTCAAGATGACAAATGG - Intergenic
1181662149 22:24359575-24359597 GACTTTATCTAGTTGGCAAAGGG - Intronic
1182253560 22:29021281-29021303 CAGTTTTAGTAGATAGCAGAAGG + Intronic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
1184958934 22:47914777-47914799 CACTTTTTCTGTGTGGCCGATGG - Intergenic
950424364 3:12916714-12916736 CACTGTTTCCAAATGGCAAAAGG + Intronic
950572385 3:13809455-13809477 CACTTTTGGGGGATGGCAGAGGG + Intergenic
950914935 3:16635032-16635054 CACCTTTTCAACATGCCAGATGG - Intronic
951789382 3:26462756-26462778 CCCTTTTCCTAGATGGCATTTGG - Intergenic
951834202 3:26963137-26963159 CACTTTTTCTGCATGGCAGATGG + Intergenic
952321307 3:32280327-32280349 CACTTTTTCTTCGTGGCAGATGG + Intronic
955090320 3:55744026-55744048 CACCTTTTCTGCATGGCAGATGG + Intronic
955821740 3:62903361-62903383 TATTTTCTCTAAATGGCAGAAGG - Intergenic
956432529 3:69201609-69201631 TACTTTATCTAGCTGGCAGCTGG + Intronic
956978134 3:74606031-74606053 CACTTTTTTTTGAGGGGAGAGGG - Intergenic
958434843 3:94083664-94083686 CACATTTTCTGCATGGCAAATGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
964627809 3:158776255-158776277 CACCTTTTCTACAGGGCAGATGG - Intronic
964828215 3:160853194-160853216 CACTTTTTCTTTTTGGCAGTGGG + Intronic
964881763 3:161431221-161431243 CCCACTTTCTAGTTGGCAGATGG + Intergenic
965757800 3:172041938-172041960 CACTTTGTTTAGATACCAGAGGG + Intronic
965986348 3:174758260-174758282 TACTTTTTCAAGAAGGCAGCAGG + Intronic
970175257 4:13332920-13332942 CCCTTTTACTGCATGGCAGATGG + Intergenic
970443675 4:16106821-16106843 TATTTTTTTTAAATGGCAGAAGG - Intergenic
972740959 4:41885663-41885685 CACTGTTTCTTGCTGGCAGTGGG - Intergenic
972798715 4:42449411-42449433 CACTGTTTGTGGATGGCAAAAGG + Intronic
973024595 4:45251500-45251522 CACCATTTCTAGATGGTGGATGG - Intergenic
974439623 4:61899360-61899382 CAATTTTTCAACATGGCAAATGG - Intronic
978984956 4:115000907-115000929 CACTCTTTCTAGTTCACAGATGG + Intronic
980606929 4:135104422-135104444 CAATTTTTTTAGATGGCAGTAGG - Intergenic
980858594 4:138471086-138471108 CAATTTTTGTATATGGCATAAGG + Intergenic
982799111 4:159680699-159680721 CCCTTTTGCTAGTTGACAGATGG - Intergenic
983528733 4:168787420-168787442 CATTTTTTCTAGAAGGGTGATGG + Intronic
984040820 4:174731457-174731479 CACATTTTGTATATGGCAAAAGG + Intronic
984300220 4:177907275-177907297 CCCTATTTCTAAATGGTAGAGGG + Intronic
986406140 5:7426815-7426837 CACTCTTTAGAGATGGCAAAAGG - Intronic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
986674766 5:10174030-10174052 TAGTTTTTATGGATGGCAGAGGG - Intergenic
986783977 5:11094278-11094300 AACATTTTCTTGATGACAGAGGG + Intronic
986987146 5:13512950-13512972 CATTATTTCTAGGTGTCAGAGGG - Intergenic
987469892 5:18315000-18315022 CACATTTTCTCCATCGCAGATGG + Intergenic
989595810 5:43155170-43155192 TACTTTTTCATGATGGCTGAGGG + Intronic
991157526 5:63457060-63457082 TATTTTTTCTAGATGCTAGATGG - Intergenic
991478332 5:67047896-67047918 CACTTTTTCTGAATAGCACAAGG - Intronic
992715511 5:79507310-79507332 CAATTCTTCTAGATGGTAGATGG + Intronic
993183436 5:84585271-84585293 CAGATTTTCTAGAAGGTAGAGGG + Intergenic
993212600 5:84973050-84973072 CAGTTTGTCAAGATGACAGAAGG - Intergenic
994714050 5:103300788-103300810 CCCTCATTCTAGCTGGCAGATGG + Intergenic
995240397 5:109879211-109879233 CTCTCTTCCTAGATTGCAGATGG - Intergenic
996519876 5:124414672-124414694 CTCTTTATTTACATGGCAGAGGG - Intergenic
998220636 5:140275780-140275802 CAGTTTGTGTAGATGGCAGGAGG - Intronic
998588239 5:143450607-143450629 CACTTTTTCCATATGAAAGAAGG - Intergenic
998914150 5:146996212-146996234 AAGTATTTCTAGTTGGCAGACGG + Intronic
999362624 5:150998650-150998672 CACCTTTTCTGCATGGCAGATGG - Intergenic
1001749836 5:174120506-174120528 CACTTTTGCTAAGTGGGAGAAGG + Intronic
1002837237 6:875147-875169 CACCTTTTCTAGAGTGCAGTGGG - Intergenic
1003031075 6:2601029-2601051 CCCTCTTTCTAGTTTGCAGATGG - Intergenic
1003995452 6:11536633-11536655 TTCTTTATCCAGATGGCAGAGGG + Intergenic
1004564599 6:16784291-16784313 CCCTTTTCCTAGTTCGCAGATGG - Intergenic
1005161162 6:22865701-22865723 CTCTCTTTCTAGTTTGCAGATGG + Intergenic
1005322531 6:24668881-24668903 CACCTTTTCTGTGTGGCAGATGG - Intronic
1006196814 6:32248383-32248405 CACCTTTTTTAAATTGCAGATGG - Intergenic
1006293319 6:33157683-33157705 CACTGATTCTAGCTGGCAGCGGG - Intergenic
1006479419 6:34279876-34279898 CATTCTCTCTAGATGGCAGGGGG + Exonic
1008331775 6:50254125-50254147 CAGTCTTTCTAGCTTGCAGACGG - Intergenic
1009036009 6:58117800-58117822 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1009211827 6:60871401-60871423 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1013534700 6:111053302-111053324 CACTTTTTATGCGTGGCAGATGG - Intergenic
1014528353 6:122528505-122528527 CCCTTTTTCTGGCTTGCAGACGG + Intronic
1015889786 6:137958876-137958898 CAGTTTTACAAGATGGAAGAAGG - Intergenic
1016010374 6:139133226-139133248 CACCTTTTCTGCGTGGCAGATGG + Intergenic
1016063209 6:139651853-139651875 CACTTTTACAGGATGGGAGAAGG + Intergenic
1017065210 6:150522546-150522568 CAGTATTTCTAGATAGCTGATGG + Intergenic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1020790909 7:12627303-12627325 AACATTAGCTAGATGGCAGAGGG - Intronic
1020821999 7:12981803-12981825 CACTTACTCTCCATGGCAGATGG + Intergenic
1023480388 7:40627668-40627690 CACCTTTTCTGCAAGGCAGATGG - Intronic
1024619578 7:51146164-51146186 CACTTTTTGAAGAAGACAGAAGG - Intronic
1026184753 7:68074000-68074022 CACCTTTTCTGCATGGCAGATGG - Intergenic
1028770810 7:94618675-94618697 AACTTATTATAGATGGAAGATGG - Intronic
1029035285 7:97513438-97513460 CTCTCTTTCTTGATTGCAGATGG + Intergenic
1031448215 7:121881211-121881233 CTCTCTTTCTGGATTGCAGATGG - Intronic
1031498698 7:122484446-122484468 CAGTATTTCTGGATGGCATATGG - Intronic
1032656868 7:133939902-133939924 GACTTTTTCTAGAGGGGAGAAGG - Intronic
1032700999 7:134379042-134379064 CACCTTTTCTGCATGGCAGATGG - Intergenic
1032843296 7:135731268-135731290 TACTTTTCCTAGATGTCAGATGG - Intronic
1035963945 8:4169332-4169354 CCATTTATCTAGATGGAAGAAGG - Intronic
1037682730 8:21110896-21110918 CACCTTTTCTGCATGGCAGATGG + Intergenic
1038578759 8:28728634-28728656 CACTTTTTTTGGAAGGCTGAGGG + Intronic
1038914558 8:32006303-32006325 TACTCTTTCTGGAAGGCAGAAGG - Intronic
1039155776 8:34554865-34554887 ACCTTCTTCTAGATTGCAGATGG - Intergenic
1039297110 8:36168721-36168743 CCCTTTTTCTATGTGGCAGATGG + Intergenic
1039341208 8:36652296-36652318 CCCTTTTTCAAGATGAAAGAAGG + Intergenic
1042343928 8:67708737-67708759 AACTGTTTCTTGCTGGCAGAGGG - Intronic
1042513740 8:69638080-69638102 CACTTGTTCTATGTGGCAGATGG - Intronic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043364787 8:79520403-79520425 CGCTTTTTCTAGCTTGCAGCTGG - Intergenic
1043465418 8:80501569-80501591 CACTGTTTTTAGTTGCCAGAGGG + Intronic
1043884629 8:85584416-85584438 AAATTATTCTAGATGGTAGATGG - Intergenic
1044047425 8:87454060-87454082 CACTTCTTATACATGGCAGCAGG - Intronic
1044295292 8:90519825-90519847 CACCTTCTCTACATGGCAGCAGG - Intergenic
1044920074 8:97160321-97160343 TAATTTTTCTATATGGCATAAGG + Intergenic
1045193599 8:99907654-99907676 CTCTCTCTCTAGAAGGCAGAGGG - Intergenic
1045630754 8:104118804-104118826 CACTCTTCCTAGTTTGCAGATGG + Intronic
1046336276 8:112792347-112792369 CTCTTTTTCTGGCTTGCAGATGG + Intronic
1046540079 8:115568884-115568906 CACTTTCTCTTATTGGCAGATGG + Intronic
1046773242 8:118137364-118137386 AAGTTTTTCTGGAAGGCAGATGG - Intergenic
1047050583 8:121107274-121107296 GATTTTTCCAAGATGGCAGAAGG + Intergenic
1047706555 8:127505266-127505288 CTCTTTTTCTTTATGACAGAGGG - Intergenic
1047848745 8:128833272-128833294 CACTTTTTCACAAAGGCAGATGG - Intergenic
1048721574 8:137331571-137331593 CACTTTGTCCAGATGTCAGACGG - Intergenic
1050235661 9:3576507-3576529 CGCTCTTTCTGGCTGGCAGATGG + Intergenic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1052284478 9:26769339-26769361 CACTTTTTCTGGCTAGCAAAAGG - Intergenic
1055959164 9:81803698-81803720 CACTGTTACCACATGGCAGAAGG + Intergenic
1056279852 9:85030380-85030402 CACTACCTGTAGATGGCAGATGG - Intergenic
1057711618 9:97450729-97450751 CACTTTTTGTAGATGACAGATGG + Intronic
1058566233 9:106288150-106288172 GACTTTTACTACAGGGCAGAAGG + Intergenic
1058760099 9:108122233-108122255 CACCTTTTCTGTGTGGCAGATGG + Intergenic
1058800779 9:108542815-108542837 CACCTCTTCTAGGTGGCAGTGGG + Intergenic
1059161762 9:112041482-112041504 CTCCATGTCTAGATGGCAGATGG - Exonic
1059443893 9:114326277-114326299 CACTTATCCTAGAAGGCAGCGGG - Exonic
1059445100 9:114333054-114333076 CACTTATCCTAGAAGGCAGCGGG - Exonic
1062137101 9:134934973-134934995 CACCTTTTCTAGCTGGTAGGGGG - Intergenic
1062293288 9:135807884-135807906 CTCCTCTTCTAGATGGCGGACGG + Intergenic
1185887453 X:3795627-3795649 CTCTTTTCCTGGCTGGCAGATGG + Intergenic
1186851160 X:13581355-13581377 CTCTGTTTCTTGATGGTAGATGG + Intronic
1186929040 X:14367855-14367877 CTCTCTTCCTGGATGGCAGATGG - Intergenic
1188601492 X:31971306-31971328 CACTTTTGCTTCATGGCTGATGG + Intronic
1188955954 X:36435337-36435359 CTTTTTTCCAAGATGGCAGATGG + Intergenic
1189064645 X:37794332-37794354 TATTTTTTCTAGGAGGCAGAGGG + Intronic
1189069537 X:37848990-37849012 CACCTTTTCTGCAGGGCAGATGG - Intronic
1189114587 X:38329583-38329605 CCCTTTTTCTGCGTGGCAGACGG + Intronic
1189761718 X:44328588-44328610 ACCTTTTTCTGCATGGCAGATGG + Intronic
1190156410 X:47996854-47996876 CACTCTTTCTGGCTTGCAGATGG - Intronic
1190939785 X:55029120-55029142 CATTTTTTCTACATGGGAAATGG - Intronic
1190957632 X:55210956-55210978 CACCTTTTCTGCGTGGCAGATGG + Intronic
1193926788 X:87496776-87496798 GTCTTTTCCTGGATGGCAGAGGG - Intergenic
1194024337 X:88733548-88733570 GATTTTTTGTAGATAGCAGATGG + Intergenic
1194488637 X:94518664-94518686 CTCTTTTTCTAGTTTTCAGATGG - Intergenic
1194795673 X:98209002-98209024 ACCTTTTTCTAGATGAAAGAAGG + Intergenic
1195331846 X:103809212-103809234 CCCTTTTACTAGCTTGCAGATGG - Intergenic
1196071152 X:111523682-111523704 CATTTATTCTAGAGGGCAAATGG - Intergenic
1196392111 X:115218455-115218477 CACTATTTCTGCATGGCAGATGG + Intronic
1196556213 X:117087571-117087593 CATTGTCTCTGGATGGCAGAGGG - Intergenic
1196781687 X:119389251-119389273 CACCTTTTCTGGATGGCAGATGG + Intergenic
1197064523 X:122221983-122222005 CACTTTTACCAGTTTGCAGAGGG - Intergenic
1197154991 X:123260649-123260671 CACTTTTCCCAGAAGGCAAATGG - Intronic
1197702653 X:129610926-129610948 CACTCTTTCTGGCTTGCAGATGG + Intergenic
1197739777 X:129881045-129881067 CACCTTTTCTGCCTGGCAGATGG - Intergenic
1198092568 X:133346164-133346186 CCCTTTTTCTGCATGGCAGGAGG - Intronic
1200774904 Y:7161511-7161533 CTCTTTTCCTGGCTGGCAGATGG - Intergenic