ID: 1178888921

View in Genome Browser
Species Human (GRCh38)
Location 21:36504857-36504879
Sequence CTCTGGGAGCAGTGACTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 212}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178888921_1178888924 -9 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888924 21:36504871-36504893 CTCCCAGAGATAGGAAAAGCTGG 0: 1
1: 0
2: 2
3: 23
4: 255
1178888921_1178888933 24 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888933 21:36504904-36504926 AAATTTGGGCTGATAGGACTGGG 0: 1
1: 0
2: 1
3: 22
4: 123
1178888921_1178888928 -5 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888928 21:36504875-36504897 CAGAGATAGGAAAAGCTGGGTGG 0: 1
1: 0
2: 2
3: 51
4: 782
1178888921_1178888931 18 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888931 21:36504898-36504920 AAAAGAAAATTTGGGCTGATAGG 0: 1
1: 0
2: 2
3: 47
4: 425
1178888921_1178888930 10 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888930 21:36504890-36504912 CTGGGTGGAAAAGAAAATTTGGG 0: 1
1: 0
2: 1
3: 45
4: 482
1178888921_1178888929 9 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888929 21:36504889-36504911 GCTGGGTGGAAAAGAAAATTTGG 0: 1
1: 0
2: 2
3: 45
4: 395
1178888921_1178888932 23 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888932 21:36504903-36504925 AAAATTTGGGCTGATAGGACTGG 0: 1
1: 0
2: 1
3: 14
4: 416
1178888921_1178888925 -8 Left 1178888921 21:36504857-36504879 CCCATGAGTCACTGCTCCCAGAG 0: 1
1: 0
2: 1
3: 15
4: 212
Right 1178888925 21:36504872-36504894 TCCCAGAGATAGGAAAAGCTGGG 0: 1
1: 0
2: 3
3: 39
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178888921 Original CRISPR CTCTGGGAGCAGTGACTCAT GGG (reversed) Intronic
900421803 1:2558980-2559002 CTCTGCGCTCAGTGACTCAAAGG - Intronic
902343408 1:15799198-15799220 CTCTGGGGCCTGTGAGTCATGGG + Intergenic
908531994 1:65042672-65042694 TTCTGAGAGCACTGACTCAACGG + Intergenic
909305946 1:74076736-74076758 GTCTCCAAGCAGTGACTCATAGG + Intronic
912077936 1:105900443-105900465 CTCTAGGACCAGGGACTGATGGG - Intergenic
912543797 1:110436598-110436620 AGCTGGGAGCATTGACTCCTGGG + Intergenic
912686580 1:111772494-111772516 CTCTGAGAGCAGTGATGCTTTGG - Intronic
912692642 1:111815934-111815956 CACTGCCAGCAGTGACTCCTAGG + Intronic
913129867 1:115829436-115829458 CTCTGGTGAGAGTGACTCATCGG + Intergenic
915018774 1:152760633-152760655 CTCTGGGAGCGGCGTCTGATGGG - Exonic
916071284 1:161171543-161171565 CTCTAGGGGCAGGGACTCCTAGG + Exonic
916634988 1:166658902-166658924 CACTGGGTCCACTGACTCATAGG - Intergenic
917665139 1:177218873-177218895 CTCTGGGAGGAGTGAAGCCTGGG + Intronic
919779757 1:201214179-201214201 CCCTGGGAGAAGTGGCCCATGGG - Exonic
920086340 1:203420549-203420571 CTCTTGGAGCAGTGACTTAGAGG - Intergenic
920648089 1:207817959-207817981 CTCTGGTAGGAGTGGCTCCTGGG - Intergenic
923015948 1:230126827-230126849 CGCTGGGTGCAGTCACTCCTTGG - Intronic
923461454 1:234213081-234213103 CTCTGGCAGAAGTGGCTCCTAGG - Intronic
923995750 1:239492381-239492403 CTCTGCGAGCAATGAAGCATAGG - Intronic
924513624 1:244748773-244748795 CTCCGGGAGCATGGAGTCATGGG - Intergenic
1063223918 10:3996553-3996575 CACAGGGAGCAATAACTCATTGG - Intergenic
1064295750 10:14077663-14077685 ATCTGTGAGAAGTGATTCATTGG + Intronic
1065645631 10:27831104-27831126 TTCTGGGAGCACTGTCTCCTGGG - Intronic
1065850186 10:29781380-29781402 CTCTGGGAGCAGTGGATGTTAGG - Intergenic
1067172509 10:43920135-43920157 CTCTGGGAGCTTTGTCTCAGAGG + Intergenic
1071565509 10:86669572-86669594 CTCCAGGAGCAGGGACTGATGGG + Intronic
1073276090 10:102312735-102312757 CACCAGGAGCAGTGTCTCATGGG - Intronic
1073323289 10:102628436-102628458 CTCAGGGACCAGTGACTTGTGGG - Intronic
1074916818 10:117964744-117964766 CTCTCTGAGCACAGACTCATTGG + Intergenic
1075345576 10:121679668-121679690 CTCTGGGAGGAGTGACTGTGTGG + Intergenic
1075845016 10:125538291-125538313 CTCTGGGAGCCCTGGCTCACTGG - Intergenic
1075970779 10:126650358-126650380 CTCTGTTCCCAGTGACTCATAGG + Intronic
1076112783 10:127873515-127873537 CTGTGGGAACAGTGACTTACGGG + Intergenic
1078742421 11:14079640-14079662 CTGTGGGAGCAATAACCCATAGG - Intronic
1078865607 11:15294613-15294635 CTCTGAGAGCAGAGACAAATGGG - Intergenic
1079232972 11:18665689-18665711 CTCTGGAATCAGTGACACAGAGG + Intergenic
1079737479 11:24014210-24014232 CTCAGGGAGCTTTTACTCATGGG - Intergenic
1080595089 11:33765867-33765889 CTCAGGGAGCTTTTACTCATGGG - Intronic
1082665544 11:55971370-55971392 CTCCGGGAGCAGTGGCACACAGG - Intergenic
1083596858 11:63921754-63921776 CTCATGGAGCAGTGAGCCATGGG - Intergenic
1085302446 11:75466505-75466527 CTCTGGGAGCAGGGCCAGATTGG - Intronic
1086251551 11:84820853-84820875 CTATGGAAGAAGAGACTCATTGG - Intronic
1086440263 11:86822745-86822767 CTCTGGGAGCAGAGAGACATGGG + Intronic
1089529466 11:119116912-119116934 CTCTGTGAGCAGTGGCTCTGTGG + Exonic
1090070938 11:123544490-123544512 CTCTTGGAGCATTCACTCCTTGG + Intronic
1090355010 11:126134402-126134424 GTCTGGGAGCAGTGTCTAACGGG - Intergenic
1091595107 12:1872981-1873003 ATCTCGGAGCAGTTACACATGGG + Intronic
1091857870 12:3753449-3753471 CTCTGGGAGCAGAAACTAAAGGG + Intronic
1095850302 12:46796627-46796649 CTCTAGGAGCAGTTACTCCGGGG + Intronic
1096110820 12:49028061-49028083 CTCTGGGAACAGCACCTCATAGG + Exonic
1096497927 12:52049461-52049483 CTGTGGGACCAGTGAGGCATGGG + Intronic
1097598449 12:61663697-61663719 CTCTGGGAGCTCTGTCTCAGAGG + Intergenic
1102704070 12:114866107-114866129 CTGTGGGAGCAGTTACCCACTGG + Intergenic
1103291680 12:119851354-119851376 GTCTGGGAGTAGTGACACACCGG + Intronic
1103451491 12:121032454-121032476 CTTTGGGAGCACTAACTCACTGG - Intronic
1103533735 12:121620475-121620497 ATCTGGGAGTGGTGACTCAGAGG - Intergenic
1105001928 12:132695665-132695687 CGCTGGGAGCAGAGAGTCAACGG + Intronic
1106569540 13:30914752-30914774 CTGTGGGATCACTGACCCATTGG + Intronic
1106927869 13:34632036-34632058 CTCAGGGATCAGTAACTCAAGGG + Intergenic
1106986046 13:35352302-35352324 CTTGGGGAGCAGTTTCTCATAGG + Exonic
1108315800 13:49236013-49236035 CTATAGGAGCAATGACTCCTGGG + Intergenic
1110165821 13:72441932-72441954 ATCTCTGAGCAGTGACTCCTGGG - Intergenic
1111813344 13:93119675-93119697 CTCAGGGAGCCTTTACTCATGGG + Intergenic
1112388650 13:98962985-98963007 CTCTGTGAGCAGTGTCCCATGGG - Intronic
1113397465 13:109961999-109962021 TCCTGGGGGCAGTGACACATTGG + Intergenic
1113448789 13:110390821-110390843 CCATGGGAACAGGGACTCATCGG - Intronic
1116116601 14:40659742-40659764 ATTTGGGAGCAGTGAGTAATAGG - Intergenic
1117487286 14:56211188-56211210 CACTGGCAGCATTGACTCAAGGG - Intronic
1118323456 14:64766675-64766697 CTCTGGCTGCAGTGACTCCCAGG + Intronic
1119780692 14:77275213-77275235 CTCTGGGAGCAAGGCCACATGGG - Exonic
1121644402 14:95507932-95507954 CTGTGGGACCAGTGTCACATGGG - Intergenic
1124503622 15:30252669-30252691 GGCTGAGAGCAGTGACTCCTAGG - Intergenic
1124739933 15:32285969-32285991 GGCTGAGAGCAGTGACTCCTAGG + Intergenic
1125460083 15:39897970-39897992 CCTTGGGAGCAGTGACAGATAGG - Intronic
1125599079 15:40906000-40906022 CTCTGGGAGCAGGGAGCAATAGG - Intergenic
1125908188 15:43413080-43413102 CCCTGGGAGCTCTGACACATAGG - Intronic
1126386688 15:48100675-48100697 CTCTGGGGGCAAAGACTGATGGG - Intergenic
1129263633 15:74382572-74382594 GTCTGGGAGCTGTCACTCCTGGG - Intergenic
1129566937 15:76633299-76633321 CTCTGGGAGCTCTGACCCAGAGG + Intronic
1130650853 15:85761327-85761349 CTCTGGAAGCACAGACTCACTGG - Intronic
1131448423 15:92518816-92518838 TCCCGGGAGCAGTGACTCTTCGG + Intergenic
1132074951 15:98812179-98812201 CTCTGGGAGCCATGGCTCTTGGG + Intronic
1132716028 16:1290192-1290214 CTCTGGGAGCTGCGGCTCCTCGG - Intergenic
1132771466 16:1565872-1565894 CTCTCCCTGCAGTGACTCATGGG + Intronic
1134352122 16:13447388-13447410 CTCTGAGAGCAATAACTGATAGG + Intergenic
1136288841 16:29259684-29259706 CCCTGGGTGCAGTGATGCATGGG + Intergenic
1137335652 16:47546469-47546491 CTCTGGAAGCTTTGACTCAGAGG + Intronic
1137357229 16:47778425-47778447 CTCTGGGCGCACTGCCTTATGGG - Intergenic
1137936339 16:52638618-52638640 CTCAGGGAGCTTTTACTCATGGG + Intergenic
1138054424 16:53816971-53816993 CTGTGGGAGCAGGGAATAATTGG - Intronic
1149326524 17:55535831-55535853 GGCTGGGCGCAGTGGCTCATGGG - Intergenic
1151449365 17:74188493-74188515 AGCTGGGTGCAGTGGCTCATGGG + Intergenic
1152112823 17:78366486-78366508 CTCTGGGAGACGTGCCTCTTGGG + Intergenic
1153449342 18:5209550-5209572 CCCTGGGAACATTGGCTCATTGG + Intergenic
1154399738 18:14025320-14025342 CTCTGGGAGAACTGAATAATGGG + Intergenic
1154946493 18:21166752-21166774 CTCAGGGAGCTTTTACTCATGGG - Intergenic
1159936575 18:74373024-74373046 GGCTGGGCGCAGTGGCTCATGGG + Intergenic
1160072397 18:75640233-75640255 CCCTGGGAGAAGAGACTTATAGG - Intergenic
1162394369 19:10408142-10408164 GGCTGGGCGCAGTGGCTCATTGG - Intronic
1162627256 19:11894614-11894636 CCCTGGGAGGAGTGACTCAGGGG - Intronic
1162639277 19:11995317-11995339 CTCTGGGAGGTATGACTCAGGGG - Intergenic
1162656881 19:12138005-12138027 CTCTGGGAGGACTGACACAGGGG + Intronic
1162660920 19:12168568-12168590 CTCTGGGAGGAGTCACACAAGGG - Intronic
1162675129 19:12293273-12293295 CTCTGGGAAGAGTGACCCAAGGG + Exonic
1162679718 19:12331694-12331716 CTCTGGGAGGAGTGGCCCAGGGG + Intronic
1162687408 19:12399574-12399596 CCCTGGGAGGAGTGACCCAGGGG + Intronic
1162691722 19:12439426-12439448 CCCTGGGAGGAGTGACCCAGGGG + Intronic
1162705112 19:12549777-12549799 CTCTGGGAGGAGTGACCCAGGGG + Intronic
1162865758 19:13545452-13545474 CTGTGGGAGCAGTATCTCAAAGG - Intronic
1163588426 19:18176658-18176680 CTCCCAGAGAAGTGACTCATTGG + Intronic
1164757479 19:30700894-30700916 CTCTGGGAGAAGTGTGTTATAGG + Intronic
1166587151 19:43959673-43959695 CTCAGGGAGCTTTCACTCATGGG - Intronic
925483670 2:4304295-4304317 TTCTGGGAGCAGTGCCTCTAGGG + Intergenic
926913311 2:17871345-17871367 CTCTGTAAGCAGTAACTCACAGG - Intergenic
929865750 2:45715955-45715977 CACTGGGAGCAGAGACTTTTAGG - Intronic
931255177 2:60565459-60565481 ATATAGGAGCAGTGACTAATAGG - Intergenic
932201204 2:69829875-69829897 CTCGGGGAGCCGTGACCCATGGG + Exonic
932296394 2:70626785-70626807 CCCTGGGAGCTGTGACCCAGGGG + Intronic
933937252 2:87216885-87216907 CATTGGGAGGTGTGACTCATTGG + Intergenic
935054327 2:99552583-99552605 ATCTGGGAGAAGTGTCTCAAAGG + Intronic
936341339 2:111635229-111635251 TTCTGGGAGCAGTGGCTCCCTGG - Intergenic
936355891 2:111748939-111748961 CATTGGGAGGTGTGACTCATTGG - Intergenic
941318361 2:164023376-164023398 CTATGGGATCATTGACTTATGGG - Intergenic
945994483 2:216424525-216424547 CCCTGGGAGCTCTGAGTCATTGG + Intronic
946018456 2:216622547-216622569 CTCTTGGAGCACTCACTCTTGGG + Intergenic
946149490 2:217754578-217754600 CTCTTGGTGCTGTCACTCATGGG + Intronic
946768565 2:223063320-223063342 CTCAGGGAGCAGTGAATTATTGG + Intronic
946804761 2:223461092-223461114 CTGAGGGAGCAGTGTATCATAGG + Intergenic
948002186 2:234577374-234577396 CCCAGGGAGCTGTTACTCATGGG + Intergenic
948020909 2:234732595-234732617 CCATGGGAGCAGTGACTTCTGGG - Intergenic
1168820320 20:768663-768685 CTCTGGGAGGAGCCACTCCTGGG + Intergenic
1170515965 20:17130721-17130743 CTCTGGTCTCAGTGAGTCATTGG + Intergenic
1170673641 20:18458345-18458367 CACTGGCTGGAGTGACTCATAGG - Intronic
1171946843 20:31386324-31386346 CTCTGGGAGCTGGGACACTTAGG - Intronic
1173000439 20:39101663-39101685 CTCTGGGACCAGTGACTAATTGG - Intergenic
1173387749 20:42604672-42604694 CTCTGGGCCCAGCCACTCATTGG + Intronic
1174093222 20:48066725-48066747 CTCTGGAAGCAGAGGCTCAGGGG + Intergenic
1175213969 20:57380327-57380349 CTGTGGGAACAGGGCCTCATGGG + Intergenic
1176059206 20:63164942-63164964 CTCTGGGGGCAGAGACACACGGG + Intergenic
1176655951 21:9589038-9589060 CTCTCGGTCCAGTGTCTCATTGG - Intergenic
1178888921 21:36504857-36504879 CTCTGGGAGCAGTGACTCATGGG - Intronic
1179819342 21:43927671-43927693 CTGTGGGAGCAGTGACTTTGTGG + Intronic
1180110512 21:45645981-45646003 CCCTGGTGGCAGTGACTCAGAGG + Intronic
1182908148 22:33956487-33956509 CTCTGAGAGCACTGCCTCCTTGG + Intergenic
1184595519 22:45511726-45511748 GGCCGGGAGCAGTGGCTCATGGG - Intronic
950632350 3:14290933-14290955 CTCTGGAGGCAGTGGCTCCTTGG - Intergenic
953657554 3:44865534-44865556 CTCTAGAAGCAGTGACTGGTGGG + Exonic
954279848 3:49569567-49569589 CTCTGGGAGCTCTGACTCAGTGG + Intronic
955189498 3:56747300-56747322 CACAGGGAGCAGTGGCCCATTGG - Intronic
955304326 3:57814692-57814714 GGCTGGGTGCAGTGGCTCATGGG + Intronic
955414204 3:58677965-58677987 CTCTGGAAGCTGTGTCTCAGAGG + Intergenic
956786666 3:72648447-72648469 GGCTGGGTGCAGTGGCTCATTGG - Intergenic
959086942 3:101861298-101861320 AAGTGGGAGCAGTGAATCATAGG + Intergenic
959314127 3:104780545-104780567 CTCTGGGAGAGCTGACACATTGG - Intergenic
959380495 3:105635683-105635705 CTATGAGAGCAGAGGCTCATAGG + Intergenic
965060352 3:163776984-163777006 GTCTGAGAGCAGTGACCAATTGG + Intergenic
965805367 3:172536341-172536363 CTCAGGGAGCTTTTACTCATGGG - Intergenic
967109527 3:186281400-186281422 CTCTCAGAACACTGACTCATTGG - Intronic
967229007 3:187319915-187319937 CCCAGCGAGCAGGGACTCATTGG - Intergenic
969305287 4:6322856-6322878 ATCTGGGACCAGTGAGGCATGGG + Exonic
969446759 4:7249340-7249362 CTCTTGGAACAGTCACTCTTGGG - Intronic
969644728 4:8421100-8421122 CTCTGGGAGCAAACACTCATCGG + Intronic
970561812 4:17288968-17288990 CTCTGTGAGCAGGGCCTTATGGG - Intergenic
971558661 4:28046030-28046052 GGCTGGGGGCAGTGGCTCATGGG - Intergenic
975673989 4:76808862-76808884 CTCAGGGAGCATTTACTCATGGG + Intergenic
977071411 4:92393036-92393058 CTCAGGGAGCTTTTACTCATGGG + Intronic
977729224 4:100331490-100331512 CTCTGGGAGCACTGTCCCAGGGG - Intergenic
977819741 4:101458166-101458188 CTCTGGGAGCACTGTCTCAGGGG - Intronic
978352573 4:107835566-107835588 CTGTGGGTGCAGTGTCGCATCGG + Intronic
980775610 4:137432014-137432036 CTCAGGGAGCTTTTACTCATGGG - Intergenic
985835026 5:2264112-2264134 CTCGGGGAGCAGTGACCCTGTGG + Intergenic
986510685 5:8503465-8503487 CTCAGGGAGCTTTTACTCATGGG + Intergenic
987855190 5:23411635-23411657 CTCTGGGAGCAGAGACCCGCAGG + Intergenic
992685788 5:79198224-79198246 CTCTGGGTGCAGGGAATAATTGG - Intronic
993595794 5:89853454-89853476 CTCTGGCACCAGTCAGTCATTGG - Intergenic
993982398 5:94558268-94558290 CTCTGGGAGCAAGGACTCCCTGG + Intronic
995264084 5:110138456-110138478 CTCTGGGATCTCTGACTCAAGGG + Intergenic
996097011 5:119409623-119409645 TTCTGGGAGTACTGACTCCTGGG - Intergenic
996332184 5:122342319-122342341 CCCTGGGAGCAGTGACTCCATGG - Intronic
996925693 5:128823761-128823783 ATCTGGGAGCTGAGACTCCTTGG - Intronic
998666027 5:144298292-144298314 CTCTGGGAGCAAGGACCCCTCGG + Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001401943 5:171451094-171451116 CTGTGGAAGCGGTGACTCAGCGG - Intronic
1002056385 5:176600029-176600051 CACTGGGAGCAGTGAAGCAGGGG - Intronic
1004515622 6:16320198-16320220 TTCTGTGAGCTGTGAGTCATCGG - Intronic
1005432048 6:25768644-25768666 GGCTGGGAGCAGTGACCGATTGG - Intronic
1005699376 6:28384480-28384502 CTCTGGGAGCCTTGACTGATGGG + Intronic
1006807480 6:36798010-36798032 CTGTGAGAGCAGTGAGGCATGGG + Intronic
1007706023 6:43791959-43791981 CCCAGGGAGCAGTGAGTCAGAGG + Intergenic
1008770240 6:54970180-54970202 CACTGGGAGTAGTGTGTCATTGG - Intergenic
1011139056 6:84133214-84133236 CTCTGGGAGCTTTGTCTCAGAGG + Intronic
1011969878 6:93209940-93209962 CTCTGGGAACAGAGACTGACAGG - Intergenic
1016588238 6:145714194-145714216 TTCTGGGACCAATTACTCATGGG - Intronic
1016623128 6:146135265-146135287 CTCTGGCAGCAGAGAGTCCTGGG - Intronic
1016944422 6:149515327-149515349 GGCTGGGTGCAGTGGCTCATGGG - Intronic
1019028720 6:168992333-168992355 CTCGGGGTGCAGGGACACATGGG - Intergenic
1023094862 7:36650180-36650202 CTCTGGGAGCAAGGACCCCTTGG + Intronic
1024202167 7:47118575-47118597 CTCTGGGAGCACAGAGTCCTGGG + Intergenic
1025282643 7:57639221-57639243 CTCTGGGTCCAGTGTCTCATTGG - Intergenic
1025302082 7:57826196-57826218 CTCTGGGTCCACTGTCTCATTGG + Intergenic
1026322988 7:69283741-69283763 CTCCGGGAGGAGTGATTGATGGG - Intergenic
1027817939 7:83001919-83001941 TTCTGAGAGGTGTGACTCATGGG + Intronic
1028626962 7:92888729-92888751 CTCTGGGAGCTCTGTCTCAGAGG + Intergenic
1029408261 7:100390844-100390866 CTCTGGGATCAGAGGCTCTTGGG - Intronic
1030220962 7:107098870-107098892 CTCTGGAAGCTTTGTCTCATAGG + Intronic
1030834349 7:114264769-114264791 CTCAGGGAGCTTTTACTCATGGG + Intronic
1033173371 7:139103378-139103400 GGCTGGGTGCAGTGGCTCATGGG - Intronic
1033276145 7:139972973-139972995 CGCTGGGCGCAGTAACTCACAGG - Intronic
1034177042 7:149108283-149108305 CTCTGGGGGCAGTGTCACTTGGG - Intronic
1037468458 8:19184002-19184024 CTTCAGGATCAGTGACTCATTGG + Intergenic
1038051751 8:23820512-23820534 CTCTCGGTCCACTGACTCATAGG + Intergenic
1039552054 8:38450487-38450509 CCCTGGGAGAAGTGAGTCCTGGG - Intronic
1040289386 8:46116586-46116608 CTCTGGCCGAAGTGACTCAGGGG - Intergenic
1041294204 8:56338122-56338144 CTCTGGAAGCTTTGTCTCATAGG + Intergenic
1045943503 8:107767526-107767548 CTCTGGGTGCTGTGGTTCATAGG + Intergenic
1049411174 8:142474651-142474673 CCCCGGGAGCAGAGACTCCTGGG + Intronic
1050956834 9:11673042-11673064 CTCTGGAAGCTTTTACTCATGGG - Intergenic
1055003284 9:71478115-71478137 CTCAGGGAGCAGACACTCCTTGG - Intergenic
1055480910 9:76708442-76708464 CTCTGGAACCAGTGAATCAGAGG - Exonic
1056395907 9:86180865-86180887 CTCTGTGAGGAGTAACTCAAAGG - Intergenic
1060671776 9:125476092-125476114 CTCTGGGAGCAGGGAGCCAGAGG + Intronic
1061887722 9:133601051-133601073 CTCTGGGAGCAGGGCCTCAGAGG + Intergenic
1203633668 Un_KI270750v1:92499-92521 CTCTCGGTCCAGTGTCTCATTGG - Intergenic
1189564087 X:42221627-42221649 CTCAGGGAGCAATGACTACTGGG + Intergenic
1191768764 X:64732700-64732722 CTCTGGGAGCTCTGTCTCAGAGG + Intergenic
1194103208 X:89734209-89734231 CTCTGGGAGCAATGACCCCCTGG - Intergenic
1195584665 X:106551736-106551758 CTCTGGGAGCAAGGACCCCTCGG + Intergenic
1199173297 X:144757006-144757028 CTCTGGGAGCTCTGACGCAGAGG + Intergenic
1200096969 X:153669067-153669089 CTCTGGGAGCAGTGGCAGCTTGG - Intergenic