ID: 1178890596

View in Genome Browser
Species Human (GRCh38)
Location 21:36517995-36518017
Sequence AGTGAGTCCCAAATCTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 9, 3: 28, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178890596 Original CRISPR AGTGAGTCCCAAATCTGATG GGG (reversed) Intronic
903362306 1:22784249-22784271 AGAGAATTCCCAATCTGATGGGG - Intronic
904424892 1:30416873-30416895 AGTGAGTGCAAAGTCTGCTGGGG + Intergenic
908883277 1:68758293-68758315 TGTGAGTCCCCAAAGTGATGGGG + Intergenic
908900341 1:68949418-68949440 AGTGAGTCAGAAGTCTGGTGAGG - Intergenic
909356535 1:74716121-74716143 GGTGAGTCTAAAATCTGTTGCGG - Intronic
909998273 1:82308396-82308418 ACCAAGTCCAAAATCTGATGAGG - Intergenic
912181858 1:107228742-107228764 AGTGTTTCCTAATTCTGATGAGG + Intronic
918212230 1:182361393-182361415 AAGGAGTCCAAAATCTGGTGGGG + Intergenic
918846073 1:189615426-189615448 ACTGTGTACCAAATCTGTTGTGG + Intergenic
919851113 1:201673625-201673647 AGAGAGCCCCCATTCTGATGTGG + Intronic
921943965 1:220873701-220873723 AATGAGGCCCAAATTTGATTTGG - Intergenic
1063209789 10:3869646-3869668 GGTGAGTCCAAAATCTGATGGGG + Intergenic
1063586479 10:7357547-7357569 AGTGAGCCCAAAATCTGATGGGG - Intronic
1064462863 10:15551696-15551718 ACTGAATCCCATTTCTGATGAGG - Intronic
1065857523 10:29842325-29842347 AGTGGGTCCCACCCCTGATGGGG - Intergenic
1065857952 10:29845628-29845650 GGTGAGTCCAACATCTGATGCGG + Intergenic
1067361578 10:45585433-45585455 AATGAGTCTCAAATCTCATACGG + Intronic
1069368217 10:67715758-67715780 TTTTAGTCCCATATCTGATGGGG - Intergenic
1069813270 10:71178132-71178154 TGTGACTCTGAAATCTGATGAGG - Intergenic
1070706584 10:78643516-78643538 TCTGAGTCCAAAATCTGATCGGG + Intergenic
1070828490 10:79404743-79404765 GGTGAGGCCCAAACCTGAAGTGG - Intronic
1072246846 10:93551240-93551262 AGGGAGTCAGGAATCTGATGAGG + Intergenic
1073465102 10:103690432-103690454 TGAGAGTCCAAAATGTGATGGGG + Intronic
1078210122 11:9264180-9264202 AGTGAGTGCCAAATCTGGTCAGG + Intronic
1078639004 11:13078000-13078022 AGTGAGTCCAAAATGTAATGTGG - Intergenic
1079727738 11:23897127-23897149 TGTGAGGCCCAAATTAGATGGGG - Intergenic
1080784809 11:35465238-35465260 ATGCAGTGCCAAATCTGATGAGG - Intronic
1084040430 11:66539538-66539560 TGTGTGTCCCACATCTGCTGTGG + Exonic
1084359245 11:68659044-68659066 AGTGAGACCCAAATCTTGTTAGG + Intergenic
1084522587 11:69673561-69673583 AGGGATTCCCAAACCTGATAGGG + Intronic
1086124335 11:83334455-83334477 AGTGAGTCCAATATCTGATGTGG - Intergenic
1092193656 12:6536607-6536629 GGTGAGCCCCAAAGCTGGTGTGG + Intronic
1095253479 12:40005521-40005543 AGTGATACCTAAATCTGAAGTGG + Intronic
1095266687 12:40167894-40167916 AGTGAGTCACAGTTCTGATTTGG - Intergenic
1099095211 12:78367173-78367195 AGTAAGTCCCAAAGATGATTTGG + Intergenic
1099841831 12:87975964-87975986 AGTGAGTCTAAAATCTCATGGGG - Intergenic
1101322315 12:103683563-103683585 AGTAAGTCCCAAATATGGTGTGG + Intronic
1101698215 12:107146906-107146928 GGTGAGTCCAAAATCTGATAGGG - Intergenic
1102506741 12:113388767-113388789 AGTGGGTCACGAACCTGATGGGG + Exonic
1103916126 12:124376568-124376590 AGAGAGACCCAAAGCTGGTGGGG + Intronic
1105255816 13:18743565-18743587 AGGGAGTCCCACTTCAGATGTGG - Intergenic
1105468400 13:20668875-20668897 AGTCAGTTCCAAAAGTGATGAGG + Intronic
1106509967 13:30404357-30404379 AATGAGTCCCAAATTTTCTGTGG - Intergenic
1106798254 13:33229972-33229994 AGTGAATCCCACAGCTGTTGTGG + Intronic
1110384286 13:74890711-74890733 GGTGAGTCCAAAATCTGATGGGG - Intergenic
1111186849 13:84748716-84748738 GGTAAGTCCAAAATCTGATCGGG - Intergenic
1112560375 13:100507529-100507551 AGAGAGGCCTAAAACTGATGTGG - Intronic
1112664682 13:101556304-101556326 AGTGGGTCCTTAATCTGATATGG + Intronic
1112770146 13:102786296-102786318 AGTGAGCCCCAAATCCGAGAGGG - Exonic
1112830779 13:103447660-103447682 AGTGTATCCCAAATCTCTTGGGG + Intergenic
1116653704 14:47626426-47626448 AGTGAGTGCCAAAGCCGAGGAGG - Intronic
1117297885 14:54395644-54395666 GGAGAGTCCAAAATCTGATGGGG - Intergenic
1117414300 14:55479527-55479549 GCTGAGTCCAAAATCTGGTGGGG + Intergenic
1120456810 14:84741097-84741119 AGCGATTCCAAAACCTGATGGGG - Intergenic
1121743367 14:96269213-96269235 GATGAGTCACAAATTTGATGAGG + Intergenic
1123120652 14:105914873-105914895 AGTGAGGCCCAGGTCAGATGAGG + Intergenic
1125755856 15:42064401-42064423 GGTGAGTCCAGAGTCTGATGGGG + Intergenic
1126710618 15:51451833-51451855 AGTGATTCCCAACTAGGATGGGG + Intronic
1127292493 15:57582865-57582887 AGTGAGACCCAAGTTTGATGAGG - Intergenic
1128089942 15:64912464-64912486 AGTGCGTGCCCCATCTGATGCGG - Intronic
1130651499 15:85764527-85764549 AGCCAGTCCCAGATCTGATGGGG - Intronic
1133874450 16:9720615-9720637 AGTGGGACCCAGATCTGATAGGG + Intergenic
1133889540 16:9866234-9866256 AGTGAGAGGCAGATCTGATGAGG + Intronic
1134823774 16:17267851-17267873 AATGAGTACCCAATCTAATGAGG + Intronic
1137017030 16:35387766-35387788 AGTGAAGCCCAATTCAGATGAGG - Intergenic
1138074762 16:54031160-54031182 AGCAAGTTCCAAATATGATGAGG + Intronic
1140023030 16:71257403-71257425 GGTGTGTCCCATCTCTGATGAGG - Intergenic
1141064213 16:80900918-80900940 AATGAGTCCCTAATCTGAGGAGG - Intergenic
1143061569 17:4206372-4206394 GGTTAGTCACAAAGCTGATGTGG - Exonic
1147583506 17:41639506-41639528 AGGGAGCCCCCAATCTGAGGGGG - Intergenic
1147850104 17:43435863-43435885 AGACAGTCCCAGATCTGGTGGGG - Intergenic
1148699286 17:49578264-49578286 AGGGAGTCCCCAGTCTGATGGGG - Intronic
1150437077 17:65162430-65162452 AATGTATCCCAAATCTGATTAGG - Intronic
1151170287 17:72239873-72239895 GGTGAGTCCAAAATCTGATGGGG - Intergenic
1154073631 18:11178116-11178138 TCTGAATCGCAAATCTGATGAGG - Intergenic
1154314856 18:13296537-13296559 GGTGGGTCCCTAATCTGACGGGG - Intronic
1156006147 18:32444525-32444547 AGTGACTCCCAAATATGCAGTGG - Intronic
1157689835 18:49672458-49672480 GGTGAGCCCAAAATCTGATGGGG + Intergenic
1158389363 18:57032191-57032213 TGTGAGTCCTAAATCTAATGCGG - Exonic
1159207792 18:65275757-65275779 GGAGAGTCCAAAATCTGATAAGG - Intergenic
1159844990 18:73448338-73448360 AGTGAGGCCCTGATCTGATAGGG + Intergenic
1164418264 19:28064051-28064073 AGTGAGTCCTAGCTCTGCTGAGG - Intergenic
1165063569 19:33216558-33216580 AGAGAAGCCCAAACCTGATGTGG - Intronic
932000008 2:67876478-67876500 AGTGAGTCCCATGTCTGAGTTGG - Intergenic
932700260 2:73986521-73986543 AGTGAGTCCCAACTCCGAGGGGG + Exonic
936646853 2:114382325-114382347 AGTGATTCCTAAATCTCAAGGGG + Intergenic
942910857 2:181242589-181242611 GGTGAGTGCAAAATCTAATGGGG - Intergenic
944314301 2:198268884-198268906 GGTGAGTCCAAAATCTGATGGGG - Intronic
946464877 2:219903037-219903059 GGTGAGTCCGAAGACTGATGGGG + Intergenic
947294842 2:228618828-228618850 GGTGAGTCCAAAATCTGATGGGG - Intergenic
947892752 2:233640587-233640609 AGTAAGTTCCAAATTTTATGAGG + Intronic
1169733123 20:8808415-8808437 AGTAGGTCCCTGATCTGATGGGG - Intronic
1170990594 20:21298569-21298591 GATGAGTCCAAAATCTGATGGGG + Intergenic
1173107274 20:40149799-40149821 AGTGAGTCACAAACCGGAGGAGG - Intergenic
1173653878 20:44685467-44685489 ATTTAGTCCCAACTCTGGTGGGG + Intergenic
1173896532 20:46555251-46555273 AGCAAGTCCAAAATCTGATGGGG - Intergenic
1178890596 21:36517995-36518017 AGTGAGTCCCAAATCTGATGGGG - Intronic
1181108080 22:20586374-20586396 AGTGAGAACCAAATCTGAACAGG - Intronic
1181295147 22:21832136-21832158 AGTGATTTCTAAATCTGAAGAGG + Intronic
1181403052 22:22663246-22663268 AGACAGCCCCAAATCTGAAGGGG - Intergenic
955068334 3:55551584-55551606 GGTAAATCCAAAATCTGATGGGG + Intronic
955410215 3:58650514-58650536 AATGAGGCCCTAATCTGTTGAGG + Intronic
956381296 3:68667128-68667150 AGTTTCTCCCAAATGTGATGAGG + Intergenic
957564630 3:81867833-81867855 AGTTAGTTCCAATTCTGTTGAGG - Intergenic
957812824 3:85248897-85248919 AGTGAAGGCCAAATCTGATCTGG + Intronic
963625705 3:147670005-147670027 AGTGAGTCCGAAGTCTGTTATGG + Intergenic
965491321 3:169339875-169339897 AGTGAGTCAAATATATGATGTGG + Intronic
966253213 3:177889894-177889916 AGTGACTTCCAAGTCTGCTGTGG - Intergenic
967436054 3:189447727-189447749 CCTGAGGCCCAATTCTGATGGGG + Intergenic
971071565 4:23098852-23098874 AGTGAGTCCAAAATCTGGTGGGG - Intergenic
973211739 4:47622788-47622810 GGTGAATCCAAAACCTGATGAGG - Intronic
975098009 4:70479953-70479975 AGTGAGTTCCTAATCAGAAGAGG + Intronic
979789188 4:124756680-124756702 GACAAGTCCCAAATCTGATGTGG - Intergenic
990555032 5:56924510-56924532 AGTGGAACTCAAATCTGATGAGG - Intronic
991510445 5:67370841-67370863 GGGGAGTCCAAAATCTAATGGGG - Intergenic
992210370 5:74473744-74473766 GGAGAGTTCAAAATCTGATGGGG + Intergenic
992264922 5:75008976-75008998 TGAGAGTCACAAATCTGAAGGGG + Intergenic
993937719 5:94024376-94024398 AGCGAATCCAAAATCTGATGGGG - Intronic
994804469 5:104426389-104426411 GGTGAGTCCAAAATCTGATGGGG - Intergenic
995924606 5:117355914-117355936 AGTGAGTCCCAAGGTTGATCAGG - Intergenic
997047627 5:130337959-130337981 GGTGTGTCCAAATTCTGATGAGG + Intergenic
1000639500 5:163684947-163684969 AGTGAGTCTAAAATCTGGTGGGG + Intergenic
1001783015 5:174386685-174386707 TGTGAGTCCAAAATCTAATGGGG - Intergenic
1007707281 6:43798607-43798629 TGTGAGTCCCAGATCAGAGGAGG + Intergenic
1014693925 6:124595534-124595556 AGTGATTACCAAACCTGATTTGG + Intronic
1015684683 6:135846745-135846767 GGTGAGTTCCTAATCTGATGGGG - Intergenic
1020755915 7:12202841-12202863 GGTGAGTCCAAAATCTGAAGGGG - Intergenic
1024593770 7:50915027-50915049 AGTTAGTCAAAAACCTGATGGGG + Intergenic
1024743557 7:52381860-52381882 TGTGACTCCAAAATCTGATGGGG + Intergenic
1028739128 7:94251633-94251655 TGTAAGTCCCAAATCTGTGGTGG - Intergenic
1028907764 7:96174136-96174158 AGTGGGACCCAAAGGTGATGGGG - Intronic
1030453408 7:109742726-109742748 GGTAAGTCCAAAATCTGATGGGG + Intergenic
1030797258 7:113804008-113804030 ACTGAGTCCTACATCTGCTGTGG + Intergenic
1032094159 7:128929315-128929337 AGTGAGGCCCAGATCTCATGGGG - Intergenic
1032521756 7:132550796-132550818 AATAAGTCCCAAATTGGATGAGG - Intronic
1034356918 7:150458210-150458232 GGTGAGACCAAAATCTGATAGGG + Intronic
1036728567 8:11241932-11241954 AGTGAGGCGCTAATCTGATGGGG + Intergenic
1037488724 8:19376123-19376145 GGTAAGTCCCAAATCTGACAAGG + Intronic
1040629863 8:49197868-49197890 AGTAAGTCCCAAATAGGATAAGG + Intergenic
1041189846 8:55342417-55342439 AGTGAGGCCAACATCTCATGAGG - Intronic
1044774764 8:95676791-95676813 ACTGAGTCCCCAATTTCATGTGG - Intergenic
1047470288 8:125164530-125164552 AGTGACTCCCCACACTGATGTGG + Intronic
1047909522 8:129512360-129512382 AGTTTGTCCCAAAAATGATGGGG + Intergenic
1051685416 9:19653355-19653377 AATGAGTCCCCAATCTCAAGAGG - Intronic
1054712428 9:68524676-68524698 GATGAGTCCCACATCAGATGAGG - Intronic
1055913818 9:81379940-81379962 AGTGAGTACCAGATCAGATTAGG + Intergenic
1056840559 9:89995450-89995472 AGTGACTCCCTAATCTGGGGAGG - Intergenic
1057065701 9:92048621-92048643 AGTGAGTCCCAGACTTCATGGGG + Intronic
1057937605 9:99253917-99253939 GGTGAGCCCCAAAGCCGATGGGG - Intergenic
1059771492 9:117430776-117430798 AATGGGACCCTAATCTGATGGGG - Intergenic
1061101037 9:128492584-128492606 AGGGAGCCCCCAGTCTGATGGGG - Intronic
1186116328 X:6308430-6308452 AGTGAGTAGAAAATTTGATGAGG + Intergenic
1187797948 X:23024826-23024848 GGTGAATCCAGAATCTGATGAGG - Intergenic
1188286993 X:28339276-28339298 AGTGAGGCCCTAATCTGATAGGG - Intergenic
1190081307 X:47358810-47358832 AGTGAGACCCCCATCTGATATGG - Intergenic
1194592508 X:95816620-95816642 AGCAAGTCCAAAATCTGATGGGG - Intergenic
1195303055 X:103550911-103550933 GGTGAGTCCAAAATTTGATGGGG - Intergenic
1197452533 X:126637817-126637839 GGTGAGTCCAAAATCTTATTTGG - Intergenic
1197870326 X:131058025-131058047 GGTGAGCCCCAAATCTGAGAGGG - Intergenic
1200882795 Y:8236784-8236806 AATGAGTCAAAAATGTGATGTGG - Intergenic
1200932254 Y:8707653-8707675 AGTGAGGATAAAATCTGATGAGG - Intergenic
1201556261 Y:15267169-15267191 AGTGAGTTCCAAGGCTGAGGAGG - Intergenic
1202163704 Y:21963888-21963910 AGTCAGTCCCAAATGTCATTTGG - Intergenic
1202227652 Y:22622477-22622499 AGTCAGTCCCAAATGTCATTTGG + Intergenic
1202315505 Y:23573701-23573723 AGTCAGTCCCAAATGTCATTTGG - Intergenic
1202555296 Y:26096896-26096918 AGTCAGTCCCAAATGTCATTTGG + Intergenic