ID: 1178892843

View in Genome Browser
Species Human (GRCh38)
Location 21:36534395-36534417
Sequence ACCTTGCTCTGGTTCCCACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178892843_1178892848 26 Left 1178892843 21:36534395-36534417 CCCCGTGGGAACCAGAGCAAGGT No data
Right 1178892848 21:36534444-36534466 TACAGGATGATAAAAACATATGG No data
1178892843_1178892849 27 Left 1178892843 21:36534395-36534417 CCCCGTGGGAACCAGAGCAAGGT No data
Right 1178892849 21:36534445-36534467 ACAGGATGATAAAAACATATGGG No data
1178892843_1178892847 9 Left 1178892843 21:36534395-36534417 CCCCGTGGGAACCAGAGCAAGGT No data
Right 1178892847 21:36534427-36534449 CAAAGCTCTTTGACAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178892843 Original CRISPR ACCTTGCTCTGGTTCCCACG GGG (reversed) Intronic