ID: 1178893100

View in Genome Browser
Species Human (GRCh38)
Location 21:36536310-36536332
Sequence GAGGGAGAACTGAGGATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 9, 3: 58, 4: 732}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178893100 Original CRISPR GAGGGAGAACTGAGGATGGG TGG (reversed) Intronic
900369393 1:2324663-2324685 GAGGTAGCAGTGAGGATGGGAGG + Intronic
900391542 1:2436064-2436086 GAGGGAGGAGAGAGGAAGGGAGG - Intronic
900391559 1:2436117-2436139 GAGGGAGCAGGGAGGAAGGGAGG - Intronic
900391574 1:2436161-2436183 GAGGGAGCAGGGAGGAAGGGAGG - Intronic
900391660 1:2436414-2436436 GAGGGAGAAAGGAGGAAAGGTGG - Intronic
900628845 1:3623297-3623319 GAGGAAGAACAGAGGCCGGGAGG - Intergenic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900699111 1:4033005-4033027 GAGGGAGATCTGGAGAGGGGAGG + Intergenic
900798122 1:4721648-4721670 GAGGAAGAAGAGAGGATGTGTGG + Intronic
900833963 1:4985608-4985630 GTTGGAGAACAGAGGATGTGGGG - Intergenic
901225410 1:7610481-7610503 GAGGAGAAACTGAGGCTGGGGGG - Intronic
902207949 1:14883559-14883581 GAGGGATGATGGAGGATGGGAGG - Intronic
902275635 1:15337392-15337414 GTGGGAGAAGTGAGGATGAGAGG - Intronic
902387609 1:16084643-16084665 GCGGGAGAGAAGAGGATGGGTGG + Intergenic
902410205 1:16207785-16207807 GGGCGAGAACTGAGGGTGGGGGG + Intronic
902682634 1:18054426-18054448 GGGGGAGAGCTGAGGAAGAGTGG - Intergenic
902777190 1:18682525-18682547 AGTGGAGAACTGGGGATGGGAGG + Intronic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903756702 1:25667097-25667119 GAGGAGGATGTGAGGATGGGAGG + Intronic
903930889 1:26861976-26861998 GAGAGAGGACTGAGAAAGGGAGG - Intergenic
904003358 1:27350780-27350802 GACGGAGTACTGAGGACAGGAGG - Exonic
904065845 1:27750133-27750155 GAAGGAGAACTGTGAATGGGAGG - Intronic
904939159 1:34152814-34152836 GAGAGAGATCTGTGGATGGATGG - Intronic
905230870 1:36514349-36514371 GTGGGAGATTGGAGGATGGGAGG - Intergenic
906037988 1:42764883-42764905 GAGGGAGAACAGAGAAAGGCAGG - Intronic
906509166 1:46401082-46401104 GAGGGGGAAGTGGGGAGGGGAGG + Intronic
906753312 1:48285733-48285755 GAGGGAAAGCTGAAGCTGGGTGG - Intergenic
907092559 1:51741418-51741440 GAGGGAGAAGGAAGGATGGAAGG - Intronic
907304443 1:53505970-53505992 GTGGGCAAACTGAGGCTGGGAGG - Intergenic
907372164 1:54010624-54010646 GGGGAGGAACTGAGGAAGGGAGG - Intronic
907612900 1:55890353-55890375 GAGGGAGGACTGTGAATGGAGGG - Intergenic
908319864 1:62968686-62968708 GAGGGAGGATGGAGGAAGGGAGG + Intergenic
908759390 1:67498070-67498092 GAGGGAGAGGTGAGGATGGAAGG + Intergenic
908779810 1:67679975-67679997 TAGAGAGAAATGAGCATGGGGGG + Intergenic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
910908930 1:92213741-92213763 GAGGATCATCTGAGGATGGGTGG + Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911342039 1:96651403-96651425 GAGGGTGAGCTGAAGAAGGGCGG + Intergenic
911581957 1:99644501-99644523 TAGGGAGACCAGAGAATGGGAGG - Intergenic
912107570 1:106299024-106299046 GAGGTTGAAATGAGTATGGGGGG + Intergenic
912363510 1:109114009-109114031 GAGGGAGGAGGAAGGATGGGCGG + Exonic
913243117 1:116847640-116847662 GAGAGAGAAATGAGGGTTGGGGG + Intergenic
913385440 1:118253642-118253664 GAGGGAGAATCCAGGAAGGGGGG - Intergenic
914991192 1:152501016-152501038 GAGGGAGGAAGGAGGAAGGGAGG - Intergenic
915329839 1:155104003-155104025 GAGGGAGGAGGGAGGAAGGGAGG + Intergenic
915599038 1:156910785-156910807 GAGGGGGTGCTGAGGACGGGAGG + Intronic
915919296 1:159962185-159962207 CAAGGGGAACAGAGGATGGGAGG + Intergenic
916476640 1:165175536-165175558 GAGGCAGAACAAAGCATGGGAGG - Intergenic
916735126 1:167600801-167600823 GAGGGTCAACTGAGCCTGGGAGG + Intergenic
916939369 1:169663504-169663526 CATGGAGAACTGAGGAAGGTCGG - Intronic
917365859 1:174231663-174231685 GAGGGAGGCCTCAGGAGGGGAGG + Intronic
918461913 1:184785263-184785285 GAGGTAGAGCGGAGAATGGGAGG + Intergenic
919347983 1:196410991-196411013 GAGGGAGCAATGAGGAAGGAAGG - Intronic
920363362 1:205434744-205434766 GAGGGAGAATGGAGACTGGGGGG - Intronic
920536393 1:206739429-206739451 GGGGGAGGACTTAGGAAGGGAGG - Intergenic
921691414 1:218155653-218155675 GAGGGAGGCTTGAGCATGGGAGG - Intergenic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922563602 1:226586936-226586958 GAGGGTGAACTGAGGAGACGGGG - Intronic
922878520 1:228960780-228960802 GATGGGAAACTGAGGATGGCAGG + Intergenic
923506091 1:234608381-234608403 GACGGAGAGCAGAGGAAGGGTGG - Intronic
923784490 1:237054286-237054308 GAGGGAGGAAGGAGGAAGGGAGG - Intronic
923848313 1:237762880-237762902 GAGTGATGACTGAGGAAGGGAGG - Intronic
924440625 1:244082540-244082562 GAGGGAGAAGAGAGGCAGGGAGG + Intergenic
924459639 1:244247620-244247642 GAGGGAGAGCAGAGACTGGGGGG + Intergenic
924818771 1:247467146-247467168 GGTGGTGAGCTGAGGATGGGTGG - Intergenic
1062812586 10:477594-477616 GAGGGAGGAAGGTGGATGGGTGG + Intronic
1062819580 10:524056-524078 GCGTGAGAACTGAGGGCGGGAGG - Intronic
1062995132 10:1858482-1858504 GTGAGAAAACTGAGGCTGGGAGG + Intergenic
1063185897 10:3651292-3651314 GAGAGAGAAATGAAAATGGGTGG - Intergenic
1063360806 10:5456216-5456238 GATGGAGATGTGAGAATGGGAGG + Exonic
1063657125 10:8002130-8002152 GAGAGAGAACAGAGGATGATAGG - Intronic
1063688198 10:8258477-8258499 GAGTTAGCCCTGAGGATGGGAGG - Intergenic
1064487734 10:15813241-15813263 GAGGGAGCACTGAGAATTAGGGG - Intronic
1065122081 10:22540150-22540172 GAGGGAGAAGTGAGCCTGGAGGG + Intronic
1065231090 10:23599084-23599106 GAGGGCGAGCTGAGGCAGGGCGG - Intergenic
1065959439 10:30722518-30722540 GAGGGATGGCTGAGGATGGTGGG - Intergenic
1066482369 10:35809409-35809431 GAGGCAGGACTGGGGATAGGTGG - Intergenic
1067187734 10:44044586-44044608 GGGGGAGAAATGAGGCAGGGAGG - Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1068711637 10:60141345-60141367 AAGGGAGAACTGGGGTTGGCTGG + Intronic
1069234338 10:66051046-66051068 GAGGGAAAAGTGAGGGTGTGGGG + Intronic
1069742740 10:70695868-70695890 CAGGGAGAGCTGATGATGGGAGG + Intronic
1069784647 10:70979974-70979996 GAGGGAAAAGTGAGTCTGGGTGG - Intergenic
1069887221 10:71631422-71631444 GAGGGAGCACTGATGACAGGAGG + Intronic
1070644549 10:78192569-78192591 GAGGGCCAACTCAGGCTGGGAGG + Intergenic
1070698617 10:78582458-78582480 CAAGGAGCATTGAGGATGGGTGG + Intergenic
1071452052 10:85804976-85804998 GAAGGAAAAAAGAGGATGGGAGG + Intronic
1072371789 10:94771880-94771902 GAAGGAGGACTGAGGAAGGTCGG + Intronic
1072374527 10:94800991-94801013 GAGGGTGAGCTGAAGAAGGGTGG - Intronic
1072720708 10:97779332-97779354 GAGGGAGCAGGGAGGATGTGCGG - Intergenic
1073240550 10:102055352-102055374 GAGGAAGAACTGCGGAGGGTCGG + Intronic
1074516945 10:114179281-114179303 GAGGGCGCACTGGGGATTGGAGG + Exonic
1074523307 10:114244052-114244074 GAGGCATACCTGAGAATGGGTGG + Intronic
1074776309 10:116770583-116770605 GAGGGAGGACTGAGGCAAGGTGG + Intergenic
1075718765 10:124572707-124572729 GAGGGAGAAAGGAGGAAGGGAGG + Intronic
1075747781 10:124739908-124739930 GAGGGGGAAATGCTGATGGGTGG - Intronic
1076389706 10:130090259-130090281 GAGGGACAACTGAAGCAGGGTGG + Intergenic
1076404289 10:130201815-130201837 GAGGGGGATCTGAGGAGGTGAGG + Intergenic
1076751741 10:132546776-132546798 CAGGGAGAACAGTGGCTGGGCGG - Intronic
1076782987 10:132734724-132734746 GGGGGAGAACTGAAGAGAGGTGG - Intronic
1077347430 11:2070111-2070133 GATGGAGAATTGAGAATGGAGGG - Intergenic
1077869918 11:6253072-6253094 GAGGGGGAGCAGAGGATGGAGGG - Intergenic
1077876349 11:6310970-6310992 GTGGGAGAAATGAGCATGGAGGG + Intergenic
1078085655 11:8231767-8231789 GAGGGACACCAGGGGATGGGAGG - Intronic
1078830239 11:14971434-14971456 GAGGGAGAGCTGAGTGGGGGAGG + Intronic
1078981133 11:16536474-16536496 GAGGGTGAGCTGAAGAAGGGCGG + Intronic
1079838868 11:25369015-25369037 GAGGCAAAACTCATGATGGGAGG - Intergenic
1080244003 11:30159196-30159218 TGGGGAGAGCTGAGGATGGTAGG + Intergenic
1081114215 11:39177948-39177970 GAGGGAGGATGGAGGAAGGGAGG + Intergenic
1081172094 11:39881718-39881740 GCTGGAGATCTGAGAATGGGCGG + Intergenic
1081197676 11:40181185-40181207 GATGGAGGAAGGAGGATGGGAGG - Intronic
1081219618 11:40444191-40444213 GTGGGAAAACTGAGGATCAGAGG + Intronic
1081328605 11:41777032-41777054 GAGAGAGAAGGGAGGAAGGGAGG - Intergenic
1081538816 11:44015293-44015315 GATGGGAAACTGAGGCTGGGAGG + Intergenic
1081705954 11:45181911-45181933 GAGGGAGAAGTGGGAGTGGGAGG + Intronic
1082656634 11:55865951-55865973 GAGGGAGGAGAGAGGGTGGGGGG - Intergenic
1082926460 11:58552499-58552521 AAGGGAGGACAGTGGATGGGAGG - Intronic
1082950472 11:58809673-58809695 GAGGGAGGGTTGAGGATGGATGG - Intergenic
1083003716 11:59321429-59321451 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1083216283 11:61222356-61222378 GAGGGAGAAGGCAAGATGGGAGG - Exonic
1083219165 11:61241182-61241204 GAGGGAGAAGGCAAGATGGGAGG - Exonic
1083270920 11:61572100-61572122 GAGGGAGGAATGAGGTTGGGGGG + Intronic
1083812158 11:65112142-65112164 GGGCGAGATCTGAGGATGGAAGG + Intronic
1084153787 11:67303184-67303206 GAGGCAGAGCTGAGGTGGGGAGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084492700 11:69487231-69487253 GGAGGAGAGCGGAGGATGGGAGG + Intergenic
1084876123 11:72135248-72135270 GAGGGAAAAGTGGGGATGAGAGG + Intronic
1084970961 11:72771828-72771850 AAGGGAGAGCTGAGAAAGGGAGG + Intronic
1085049597 11:73373370-73373392 GAGGGGAAACTGAGGCTAGGAGG - Intergenic
1086076961 11:82864974-82864996 GTGGGAGAGGTGGGGATGGGAGG + Intronic
1086329393 11:85738428-85738450 GGGGGAAAATAGAGGATGGGAGG + Intronic
1086361993 11:86069142-86069164 GCGGGAGAAGGGAGGAGGGGCGG - Intronic
1087045263 11:93839156-93839178 GAGTGTGAACTTAGGATGCGGGG + Intronic
1087322055 11:96675079-96675101 GTGGGAGAAGTTTGGATGGGTGG - Intergenic
1087597455 11:100272504-100272526 GAAGGAGAATGGAGGAAGGGAGG + Intronic
1088811472 11:113395477-113395499 GTGGGAGGACTGAGGGTTGGGGG + Intronic
1089589952 11:119533722-119533744 GAGGGGCAACTGAGGATGGGCGG - Intergenic
1089868174 11:121650127-121650149 GAAGGAGAATTGTGCATGGGAGG + Intergenic
1090444681 11:126753721-126753743 TACGGAGAACTGGGGATGGGAGG - Intronic
1091285326 11:134405561-134405583 GAGGGAGAAGAGAGGAGGTGAGG + Intronic
1091465349 12:679027-679049 GAGGAAGAACTGCTGATGGAAGG - Intergenic
1091607273 12:1965000-1965022 AAGGGAGAAGTGGGGAGGGGAGG + Intronic
1091680675 12:2524579-2524601 GAGTGTGAGCTGGGGATGGGAGG + Intronic
1091985242 12:4905659-4905681 GAGAGAGAACTGAGGACAGTAGG - Intergenic
1092229665 12:6769524-6769546 GAGGGAGAACTGGGGCTGCAGGG + Intronic
1092242346 12:6843086-6843108 GGGGGGGAACCGAGAATGGGAGG + Intronic
1092261163 12:6953945-6953967 GAGTGAGAAGTGAGGTTGTGAGG - Intronic
1092573738 12:9755463-9755485 GATGGAGATATGAGGATGAGGGG + Intronic
1092783084 12:12005290-12005312 GAGGGAGAGGGGAGGATGGGGGG - Intergenic
1093547591 12:20367626-20367648 AAGGGAGAGGTGAGGATAGGTGG - Intergenic
1094023887 12:25942286-25942308 GGGGAAGAACTGAGGATGTTAGG - Intergenic
1094757774 12:33492412-33492434 GAGGGTGAGCTGAAGAAGGGTGG + Intergenic
1095269647 12:40202983-40203005 CAGGGAGAAACTAGGATGGGTGG - Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1096138796 12:49225283-49225305 AAGGGATATCTGGGGATGGGAGG - Intronic
1096447609 12:51707900-51707922 GAGGTAGAAATGAGGATGCAGGG - Intronic
1096602549 12:52740313-52740335 GGGAGAGCACTGAGGATGGCTGG + Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097246424 12:57610160-57610182 GAGGGGGCACTGAAGCTGGGGGG - Exonic
1097502140 12:60417970-60417992 GAAGGTGAAGAGAGGATGGGAGG + Intergenic
1097956859 12:65495281-65495303 GAAGGGGAACTGAGGGTTGGGGG + Intergenic
1098523863 12:71464302-71464324 GAGGAAGAAAGGAGGATAGGAGG + Intronic
1098539469 12:71637934-71637956 GTGGGAGGACTGGAGATGGGGGG + Intronic
1098910957 12:76207851-76207873 GAGGAAGAAGTGAGGAAGAGAGG - Intergenic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099440019 12:82687469-82687491 GAGGGAAAAGTGAAGCTGGGAGG + Exonic
1099594591 12:84644172-84644194 AAGGGAGAAGTGGGGGTGGGGGG - Intergenic
1101877812 12:108607118-108607140 GAGGGAGGGGGGAGGATGGGAGG - Intergenic
1101921959 12:108940549-108940571 GGGAGATAACTGGGGATGGGAGG - Intronic
1101966902 12:109287862-109287884 GAGCGGGAACTGTGGTTGGGTGG + Exonic
1102395585 12:112583071-112583093 GAGGGAGGACAGTGGCTGGGAGG + Intronic
1102673637 12:114641060-114641082 GAGAGAGAAAGGAGGAAGGGAGG - Intergenic
1103072941 12:117959839-117959861 GAGGAAGGACTGAGCCTGGGAGG + Intronic
1103148267 12:118614176-118614198 GAATGAGAACTGGGGGTGGGAGG + Intergenic
1103184531 12:118945088-118945110 GAGGGAGAGCTGAGGGTTGGGGG - Intergenic
1103567699 12:121825111-121825133 AAGGGTGGTCTGAGGATGGGCGG + Intronic
1103971436 12:124675314-124675336 CAGGCAGAACTAAGGCTGGGAGG + Intergenic
1104059474 12:125255303-125255325 GAGAGAGAAGAGAGGAGGGGGGG - Intronic
1104110659 12:125701033-125701055 GAGGGAGACTGGAGGATGAGGGG + Intergenic
1104134378 12:125923445-125923467 GAGGGAGAAGAGATGATGGATGG + Intergenic
1105411844 13:20177476-20177498 GAGGGAGGACTGGGGAGGCGCGG - Intergenic
1105504468 13:20998408-20998430 GAGGGAGAGAAGAGGATGAGAGG + Intronic
1106173203 13:27306937-27306959 GAGGGACCACTGAAGTTGGGGGG + Intergenic
1106407689 13:29488082-29488104 GAGGGACAAGAGAGGAAGGGGGG - Intronic
1107014903 13:35700486-35700508 GAGAGAGAACAGAGGAAGGCAGG + Intergenic
1107597407 13:41977224-41977246 GAGGGAGCAGTGAGACTGGGTGG - Intergenic
1107888795 13:44896282-44896304 GCGGGAGGAAGGAGGATGGGAGG - Intergenic
1108686005 13:52819054-52819076 GAAGGAGAAGGGAGGAAGGGAGG - Intergenic
1109273851 13:60283016-60283038 GAGGGAGAATTAAGGAGGGAGGG - Intergenic
1109328575 13:60900180-60900202 GAGGGCGAGCAGAGGAAGGGTGG + Intergenic
1110277972 13:73661000-73661022 GGGAGAGCACTGAGGATGGTGGG + Intergenic
1110954805 13:81540759-81540781 GAGGGAGACAGGAGGAAGGGAGG - Intergenic
1111048514 13:82847076-82847098 GAGGGAGGAGGGAGGAAGGGAGG + Intergenic
1111747601 13:92290567-92290589 GAGGGAGAACATAGGATGTTTGG + Intronic
1112318658 13:98387753-98387775 CCGGTAGAACTGAGGATGGGAGG - Intronic
1112557548 13:100482478-100482500 GAGAGGGAACCAAGGATGGGTGG + Intronic
1112647329 13:101349549-101349571 GAGAGAGATGTGAGTATGGGAGG + Intronic
1112806153 13:103165798-103165820 GAGGGAGAAGGGAGTATGGCAGG + Intergenic
1112856207 13:103772775-103772797 GTGGTAGAACTGAAGATGGTAGG + Intergenic
1114656637 14:24319622-24319644 GAGGGAGTACTGTGGAGGGGAGG + Intronic
1117319349 14:54606443-54606465 GAGGCAGAGCTGAGATTGGGTGG + Intronic
1118255273 14:64200290-64200312 GAGGGAGAAGTGGGGAGGGCAGG + Intronic
1118304038 14:64639691-64639713 GAGAGAGAAAAGAGGAGGGGAGG + Intergenic
1118350063 14:64967268-64967290 CAGGGAAGACTAAGGATGGGAGG + Intronic
1118592376 14:67411288-67411310 GGGGAAGGACTGAGGAGGGGAGG + Intronic
1118632866 14:67722310-67722332 GAGAAACAATTGAGGATGGGGGG + Intronic
1118969034 14:70616360-70616382 GGGAGAGAAATGAGGAAGGGAGG + Intergenic
1119151899 14:72368202-72368224 GTGTGTGAACTGGGGATGGGGGG + Intronic
1119892055 14:78190219-78190241 GAAAGGGAACTGAGGATAGGAGG - Intergenic
1120731281 14:88004585-88004607 AAGGGAGAATTGAGGCTGAGGGG - Intergenic
1120903166 14:89593226-89593248 GAGGGAGAAAGGAGGGAGGGAGG + Intronic
1121171288 14:91856539-91856561 GAGGGAGAGCTGTGCCTGGGAGG + Intronic
1121335618 14:93076077-93076099 GAGGGAGAAGGAAGGATGGATGG - Intronic
1121335622 14:93076095-93076117 GAGGGAGAAGGAAGGATGGAGGG - Intronic
1121430709 14:93885465-93885487 TAGGGAAAACTGAGAGTGGGAGG - Intergenic
1121659468 14:95624234-95624256 GGGGGAGAACTCAGGAAGGAAGG + Intergenic
1121659496 14:95624325-95624347 GGGGGAGAACTCAGGAAGGAAGG + Intergenic
1121659513 14:95624372-95624394 GGGGGAGAACTCAGGAAGGAAGG + Intergenic
1121799555 14:96763031-96763053 AAGTGAGAATTGATGATGGGGGG + Intergenic
1121917906 14:97853123-97853145 GAGAGTGAAGTGAGGAAGGGAGG - Intergenic
1122073466 14:99220547-99220569 GAGACAGAACGGAGAATGGGGGG + Intronic
1122088423 14:99322600-99322622 GAGGGAGAACTGCGGTGGGGAGG - Intergenic
1122391907 14:101395233-101395255 GCAGGTGGACTGAGGATGGGTGG - Intergenic
1122580859 14:102770805-102770827 GAGGGAGAGCGGAGGCTTGGAGG - Intergenic
1122643639 14:103177270-103177292 GTGGGAGAAGAGTGGATGGGAGG - Intergenic
1122776459 14:104119064-104119086 GAAGCAGAAATGAGGATGGTTGG + Intergenic
1122832642 14:104408033-104408055 GTGGGAGAACTGAAAGTGGGGGG + Intergenic
1122854037 14:104551652-104551674 AAGGGAGGGCAGAGGATGGGTGG - Intronic
1122948573 14:105027078-105027100 GAGGGAGGAAGGAGGAAGGGAGG + Intergenic
1123058815 14:105585277-105585299 GAGGGAGGATTGAGGATAGATGG - Intergenic
1202902409 14_GL000194v1_random:51358-51380 GATGGAGAGCTGAGTGTGGGGGG - Intergenic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1124946546 15:34272511-34272533 GAGAGAGAACTCAGGCTGGCAGG + Intronic
1124985388 15:34604856-34604878 GAAGGAGAAGGGAGGAAGGGGGG + Intergenic
1125093490 15:35824083-35824105 GAAGAAGAACTAAGGGTGGGAGG - Intergenic
1125590910 15:40854033-40854055 GAGAGAGAACAGAGAATGAGAGG - Intronic
1125617837 15:41031525-41031547 GAAGGAGAAGGGAGGAAGGGAGG + Intronic
1127229107 15:56969372-56969394 GAGGTAGAACTGAGGATCTTGGG + Intronic
1127669151 15:61178020-61178042 GGGGAAGAAATGAGGAAGGGAGG + Intronic
1128100231 15:64992520-64992542 GAGGAGGAACTGGGGATGGAGGG + Intergenic
1128227330 15:66011223-66011245 GAGGGAGCAGTGAGGAGGGAGGG + Intronic
1128520337 15:68370706-68370728 GATGGAGAACAGATGATGGTGGG + Intronic
1128561020 15:68667715-68667737 GAGAGTGCACTGAAGATGGGCGG + Intronic
1129333708 15:74840327-74840349 GAGGCAGAGCGGAGGCTGGGAGG + Intronic
1129860271 15:78855222-78855244 GCTGGAGAACGGAGGATGGGTGG - Intronic
1129977753 15:79836642-79836664 TGGGGAGAAATGGGGATGGGGGG + Intronic
1130062481 15:80579853-80579875 GAAGGTGAACTGAAGGTGGGAGG + Intronic
1130220799 15:82018008-82018030 CTGGGAGAAGAGAGGATGGGTGG + Intergenic
1130391512 15:83459940-83459962 GGGTGAGAACTGGGGGTGGGGGG - Intronic
1130397693 15:83517885-83517907 GAGGGAGAACTGGAGGTGAGGGG - Intronic
1131033234 15:89203955-89203977 AAGAGAGAAGTGAGGAGGGGAGG - Intergenic
1132158491 15:99514330-99514352 GAGAGAGCACTGTGGAGGGGAGG - Intergenic
1132236879 15:100228819-100228841 CAGGGAGAGCTGGGGTTGGGGGG - Intronic
1132372047 15:101306123-101306145 CAGGGAGGAGTGGGGATGGGGGG + Intronic
1132396444 15:101478482-101478504 GAAGGAGGACTGAGGACAGGAGG - Intronic
1132710534 16:1264280-1264302 AAGGGAGCACTGTGAATGGGTGG + Intergenic
1132734165 16:1377458-1377480 GAGGGAGGACTCAGGGAGGGAGG - Intronic
1132827750 16:1913543-1913565 GAGGGAGAGCTGGGGAGGGCTGG + Intronic
1132896115 16:2230146-2230168 GAGGGAGCACTGGGGAGGGCAGG - Intronic
1133026834 16:2992262-2992284 GGGGGAGGACAGGGGATGGGTGG + Intergenic
1133415845 16:5606437-5606459 GAGGGAGGAATGAGGGTGGAGGG - Intergenic
1134449435 16:14354301-14354323 GAGGGGGAAGGGAGGAGGGGAGG + Intergenic
1134449445 16:14354320-14354342 GAGGGGGAAGGGAGGAGGGGAGG + Intergenic
1135528342 16:23231273-23231295 GAGTGGGAAATGGGGATGGGAGG - Intergenic
1135645711 16:24159893-24159915 GAGGGTCAACTGAGCCTGGGAGG + Intronic
1135725983 16:24854181-24854203 GAGGGAGGAGGGAGGAGGGGCGG - Intronic
1135938800 16:26803269-26803291 GAGGGAGAAAGGAAGAAGGGAGG + Intergenic
1136045938 16:27614948-27614970 GAGGGAGAAGTGAAGATGGGAGG + Intronic
1136092061 16:27927662-27927684 GGTGGAGCACTGAGGATGGGTGG - Intronic
1136346803 16:29680982-29681004 TGGGGAGGACAGAGGATGGGAGG + Intronic
1136400015 16:30011862-30011884 GGGGCAGAACTGGGGATGGCAGG - Intronic
1136581200 16:31152022-31152044 GGGGGTGATCAGAGGATGGGAGG - Intergenic
1137396106 16:48117107-48117129 GAGGAAGAATTCAGAATGGGTGG + Intronic
1137630310 16:49938699-49938721 GAGGAGCAACAGAGGATGGGTGG + Intergenic
1139162261 16:64524961-64524983 GAGGGTGAAGAGAGGATGAGGGG + Intergenic
1139248042 16:65466916-65466938 GAGGATGAAATGAGGGTGGGTGG + Intergenic
1139341320 16:66269949-66269971 GAGGGAGAGAAGAGGAAGGGAGG + Intergenic
1139426093 16:66880768-66880790 GAGGGAGAGCTGAGGTGAGGGGG + Intronic
1139501493 16:67370023-67370045 GAGGGAAAACTGATGATGCCAGG + Intronic
1139590437 16:67930111-67930133 GAGGGAGAATTGAGTAGGGGGGG + Intronic
1139967446 16:70753688-70753710 GAGGGACGACTGAGGAAGGCCGG + Intronic
1141340522 16:83199818-83199840 AAGGGAGAACTGAGGCTTAGAGG + Intronic
1141373046 16:83504988-83505010 GAGTGAAAAGAGAGGATGGGAGG + Intronic
1141912795 16:87071365-87071387 GAGGAAGGACTGTGAATGGGAGG - Intergenic
1142144282 16:88486349-88486371 GAGGGTCTACTGAGGCTGGGAGG - Intronic
1142808170 17:2382515-2382537 GAGTGAGAACTGTGGGTGAGGGG + Intergenic
1143196392 17:5079062-5079084 GAGGGAGAAGAGAGGAAAGGAGG + Intronic
1143284688 17:5780397-5780419 GAGGGAGTACTGGGGCTAGGGGG + Intronic
1143515894 17:7419032-7419054 AACGGAGAACTGAGGCAGGGTGG - Exonic
1143557252 17:7669556-7669578 GAGGGAGAGATGGGGGTGGGAGG + Exonic
1143585216 17:7847455-7847477 GAGTGACAACTGAGGGTGGAGGG + Intronic
1143754598 17:9057172-9057194 GAGGGTGAAGTGGGGGTGGGGGG - Intronic
1144572365 17:16407808-16407830 GAGGCAGAGGTGAGGGTGGGAGG + Intergenic
1144654289 17:17025407-17025429 GAGGTAGACCTGAGGGAGGGAGG + Intergenic
1145126972 17:20309541-20309563 GAGGGAGAAAGGAGGGAGGGAGG - Intronic
1145246570 17:21273526-21273548 GAGGCAGAAGTGATGCTGGGAGG + Intergenic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1145392656 17:22467835-22467857 GAGAGAGAACTGAAGAAGGGTGG - Intergenic
1146156806 17:30531110-30531132 GTGGGAGAGCTGAAGCTGGGAGG - Intergenic
1146297180 17:31659229-31659251 GAGGGAGAAATGGGGAGGGAGGG + Intergenic
1146490103 17:33274971-33274993 GTGGGAGAAATGAGGAGGGGTGG - Intronic
1146688315 17:34856580-34856602 GGGGGAGGACGGAGGGTGGGAGG + Intergenic
1146688425 17:34856905-34856927 GGGGGAGGATGGAGGATGGGAGG + Intergenic
1146811592 17:35908191-35908213 GAGGGTGAAGTGAAAATGGGAGG + Intergenic
1147120858 17:38334394-38334416 CAGGGAGGACTGAGCATGTGTGG + Intronic
1147161303 17:38570967-38570989 GAGGGAGGACAGAGGATGGAGGG - Intronic
1147268814 17:39252194-39252216 AATGGAGAACTGAGAAAGGGGGG + Intergenic
1147393654 17:40124394-40124416 GAGGGAGAGATGAGGACGGCGGG - Intronic
1147690655 17:42312677-42312699 GTGGGAGAAGAGAGGAGGGGAGG + Intergenic
1148129708 17:45255482-45255504 GCGGGAGATCTGAGGACAGGAGG + Exonic
1148431931 17:47649949-47649971 GAGGGAGAAAGAAGGAAGGGAGG - Exonic
1149187478 17:54016580-54016602 CAGGGAGAACTGGTGGTGGGCGG + Intergenic
1149533691 17:57415812-57415834 GAGGGATAGCTGTGGAGGGGTGG - Intronic
1149883281 17:60314546-60314568 GAGCTAGAACTGGGGGTGGGGGG + Intronic
1150241702 17:63639266-63639288 TAGGTAGAACGGAGGAAGGGTGG + Intronic
1150265325 17:63828571-63828593 GAGGGTGAAGTGAGAATGTGAGG + Intronic
1150633497 17:66897014-66897036 GAGTGACTTCTGAGGATGGGGGG - Intergenic
1150983698 17:70171251-70171273 GAGGGGGAAGTGGGGAGGGGAGG - Intronic
1151145354 17:72035397-72035419 GAGGGAGCACCCAGGACGGGGGG - Intergenic
1151324111 17:73368378-73368400 GAGGGGGCCCTGAGGAGGGGAGG - Intronic
1151345804 17:73500531-73500553 GAAGGAGAACTGAGGGGGGATGG - Intronic
1151345870 17:73500812-73500834 GATGGAGAACTGAGGGAGGATGG - Intronic
1151498378 17:74473382-74473404 GAGCGGGGACTGAGGATGAGAGG - Intronic
1152114707 17:78378520-78378542 GAGGGGAAACTGAGGCTTGGGGG + Intergenic
1152312598 17:79559983-79560005 GATGGTGAACAGTGGATGGGTGG + Intergenic
1152859088 17:82685226-82685248 GAGGGAGGACGGAGGAGGGAGGG + Intronic
1152861737 17:82700436-82700458 GAGGAAGAAAAGAGGATGGAAGG + Intergenic
1152902557 17:82951783-82951805 TAGGGAGGCCTGAGGAGGGGTGG + Intronic
1153098533 18:1437392-1437414 GAGGGAAATCTGAGGGTGGTTGG - Intergenic
1153193196 18:2565347-2565369 GATGGAGGTCAGAGGATGGGAGG + Intronic
1153658126 18:7303488-7303510 GGAGGAGAAGAGAGGATGGGTGG - Intergenic
1153682963 18:7517787-7517809 GAGGGAGAAGGGAAAATGGGAGG - Intergenic
1154170871 18:12049044-12049066 GAGGGAGGACTAAGGATTCGTGG - Intergenic
1154188451 18:12207782-12207804 GCTGGAGATCTGAGAATGGGTGG - Intergenic
1155047508 18:22115759-22115781 GAGGGAGAAGAGAGGAAAGGAGG + Intergenic
1155115995 18:22767584-22767606 GCAGCAGGACTGAGGATGGGAGG - Intergenic
1155520076 18:26658482-26658504 GAGGAAGAACTGATGAGGAGTGG - Intergenic
1155604909 18:27594082-27594104 GAGGGAGAGCGGAGAAGGGGAGG - Intergenic
1155699194 18:28722358-28722380 GAGGGAGAAGTGATAAGGGGGGG - Intergenic
1156035945 18:32769205-32769227 AAGGCAGAACTGAGGAGGGGTGG + Intronic
1156720826 18:40067803-40067825 AAGTGAGCACTGGGGATGGGAGG + Intergenic
1157289088 18:46397241-46397263 GAGTGAGGACTGGGGGTGGGAGG + Intronic
1157327338 18:46678644-46678666 GAGGAAGAAAAGAGGAAGGGAGG + Intronic
1157600328 18:48889529-48889551 GTGGGAGAGGGGAGGATGGGCGG + Intergenic
1157723513 18:49944859-49944881 GAGGGAGGTCTGAGGAGGAGCGG - Intronic
1158941952 18:62412688-62412710 GAGGAAGGGCTGAGGATGGGAGG - Intergenic
1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG + Intergenic
1159560062 18:69984201-69984223 CAGGGAGAACTCAGGATTTGGGG - Intergenic
1160019191 18:75167309-75167331 TAAGGAGAACTGAGGATTGAGGG + Intergenic
1160356084 18:78229520-78229542 GAGGGAGGAGGGAGGAAGGGAGG - Intergenic
1160356129 18:78229631-78229653 GAGGAAGAAAGGAGGAAGGGAGG - Intergenic
1160416406 18:78714634-78714656 GAGGGAGGCCTGAGCATTGGAGG + Intergenic
1160904770 19:1446907-1446929 GAGGGGAAACTGAGGCTGGGGGG + Intronic
1160916856 19:1500841-1500863 GAGGGAGGAGGGAGGAGGGGAGG + Intergenic
1160981324 19:1817875-1817897 GAGTGAGGACTGAGGACAGGAGG + Intronic
1161025002 19:2032659-2032681 CAGGGAGCCCTGAGGATGGCCGG + Intronic
1161384463 19:3983624-3983646 GGGGCAGAAGTGAGGAGGGGAGG - Intronic
1161415668 19:4145254-4145276 GAGGGAGAAGAGAGGAGGAGGGG + Intergenic
1161484070 19:4525322-4525344 AGGGAAGAGCTGAGGATGGGAGG + Intronic
1161623009 19:5309139-5309161 GAGAGAGAAGGGAGGAAGGGGGG + Intronic
1161624996 19:5321181-5321203 GAGGGTCAACTGAGCCTGGGAGG + Intronic
1161776134 19:6263260-6263282 GAGGCAGAACAGAGGAAGGGTGG + Intronic
1162132766 19:8537058-8537080 GAGGCAGAAGTGAAGACGGGTGG + Intronic
1162156012 19:8678442-8678464 GATGGATAGGTGAGGATGGGTGG - Intergenic
1162282121 19:9707319-9707341 GAGTAAGAACTGAGGACTGGTGG + Intergenic
1162789388 19:13055221-13055243 GAGGGAGGAGTGGGGAGGGGGGG - Intronic
1162875432 19:13617759-13617781 TAGTGAGAAGTGAGGATGGAAGG - Intronic
1163006896 19:14402534-14402556 GAGGGAGGATAGAGCATGGGAGG + Intronic
1163055509 19:14714674-14714696 GAGGGAGAGGTGAGGATGCAGGG + Intronic
1163117581 19:15197713-15197735 GCGTGGGAACTGTGGATGGGGGG - Intronic
1163502981 19:17687303-17687325 GAGGGAGACGTGAGGTGGGGGGG - Intronic
1163674301 19:18647686-18647708 GAGGGAGAGAGGAGGATGAGGGG + Intronic
1164250201 19:23469127-23469149 GAGGAGGAAATGAGGATGAGAGG - Intergenic
1164581388 19:29437563-29437585 GAGGGAGAGGTGAGGTGGGGAGG - Intergenic
1165333125 19:35152388-35152410 GAGGGAGCACTGAGGAAGACGGG + Intronic
1165335404 19:35166324-35166346 CAGTGAGAACTGGGGTTGGGTGG + Exonic
1165759221 19:38310786-38310808 GAGGGAGCTCTGAGGATGTTGGG - Intronic
1165821202 19:38677222-38677244 GAGGGAGAGCCAAGGATGGTTGG - Intronic
1166054017 19:40277965-40277987 GGGGAAGAGATGAGGATGGGAGG - Intronic
1166106701 19:40601259-40601281 GAGGGAGTGGTGAGGAGGGGGGG + Intronic
1166402810 19:42496019-42496041 GAGGGAGGAAGGAAGATGGGAGG - Intergenic
1166559113 19:43720126-43720148 GAGGGGGCACTGGGGAGGGGAGG + Intergenic
1166730952 19:45058834-45058856 GAGGGAGGACTGAACAGGGGCGG - Intronic
1166813301 19:45526883-45526905 GAGGGAGAAAGGAGAAGGGGAGG + Exonic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
1167148344 19:47695351-47695373 GAGGGAGGCCTGGGGGTGGGTGG - Exonic
1167354716 19:48996179-48996201 GAAGGAGACCTGGGGATGGGTGG + Intronic
1167505592 19:49869466-49869488 GAGGGAGAACTCAGGAAAAGCGG + Exonic
1167779932 19:51592699-51592721 GAAGGAGAAGGGAGGAAGGGAGG + Intergenic
1167857654 19:52255830-52255852 GAGGGAGAAGGAAGGAAGGGAGG + Intergenic
1168307463 19:55443145-55443167 GGGAGAGAAATGAGCATGGGCGG + Intergenic
1168517225 19:57017963-57017985 GAGGGAGAAGAGGGGATGAGAGG - Intergenic
1168517243 19:57018029-57018051 GAGGGAGAAGAGGGGATGAGAGG - Intergenic
925056145 2:858787-858809 GAGGGAGACCTCAGGATGTGAGG - Intergenic
925060067 2:884199-884221 GAGGGAGGAAAGAGGAAGGGAGG + Intergenic
925267523 2:2576542-2576564 AGGGGAGAAGTGGGGATGGGAGG + Intergenic
925752421 2:7101016-7101038 GAGGGAGAAGGGAGAAGGGGAGG - Intergenic
926010105 2:9400451-9400473 GAGGGAGGAGGGAGGATGGCAGG - Intronic
926266150 2:11323303-11323325 GAGGGGAAACTGAGGTTTGGAGG - Intronic
926712340 2:15891510-15891532 GACTGAGAGCTGGGGATGGGTGG - Intergenic
927111862 2:19869321-19869343 GTGGGAGAACCGATGCTGGGCGG - Intergenic
927985569 2:27408392-27408414 GAGGGAAAACTGCGGTAGGGAGG - Intronic
928172810 2:29014282-29014304 GAGGAAGAATTGAGGGTGTGGGG + Intronic
928400517 2:30974889-30974911 GAGGGATAAGTGAAGGTGGGAGG + Intronic
929119444 2:38472226-38472248 TAGGGATTGCTGAGGATGGGTGG + Intergenic
929128672 2:38544392-38544414 GAGAGAGAAGTGGGGATGTGGGG - Intergenic
929242255 2:39665619-39665641 GAGGGCGGACTGTGGATCGGAGG + Intronic
929279856 2:40066041-40066063 GAGGGAGAAGGGAGGGAGGGGGG - Intergenic
929839162 2:45438691-45438713 GAAGGAGAGGCGAGGATGGGGGG + Intronic
931804182 2:65788653-65788675 GAGGGAGAAATCAGAATGGGAGG - Intergenic
932051613 2:68403847-68403869 GAGGGTGAGCTGAAGCTGGGTGG - Intergenic
932188696 2:69720471-69720493 GGGGAAGAAGTGAGGATGGAGGG + Intronic
932336659 2:70935673-70935695 GAGGGAGAAGGGAAGAGGGGAGG - Intergenic
932432829 2:71685848-71685870 GGGGGAGAAGTGGGGAGGGGAGG + Intronic
934504262 2:94879042-94879064 GATGGAGAGCTGAGTGTGGGGGG + Intergenic
935135265 2:100294469-100294491 AGGGGAGAACTGAGGTTGGCTGG - Intronic
935557260 2:104523474-104523496 GAGGAAGTTCTGAAGATGGGTGG + Intergenic
935592014 2:104853226-104853248 GAGGGAGGAGGGAGGAAGGGAGG + Intergenic
936260928 2:110959165-110959187 GAGGGTTAATTGAGGATGGCAGG + Intronic
936607552 2:113973365-113973387 GAGGCAGAAGTGAGAAGGGGCGG + Intergenic
936977498 2:118234272-118234294 GAGAGGGACCTGAGGATGTGTGG - Intergenic
937135006 2:119544652-119544674 GAGGGTGACCTGAGGATGGTGGG + Intronic
937523068 2:122734983-122735005 GTGGGAGAAGAGAGTATGGGGGG + Intergenic
938067953 2:128292101-128292123 GAGGGTGAACTGAGGCCGGGGGG + Intronic
938950526 2:136250457-136250479 GCAGGAGATCTGAGGGTGGGAGG + Intergenic
939079587 2:137643777-137643799 GAGAGAGGACAAAGGATGGGAGG + Intronic
939606741 2:144262995-144263017 AAGGGAGGACAGAGGAGGGGAGG + Intronic
941061817 2:160856072-160856094 GCGGGAGATCTGAGAATGGTCGG - Intergenic
942410952 2:175708960-175708982 GAGGGTGAACTGAAGCCGGGTGG + Intergenic
942545777 2:177062284-177062306 GTGGGAGGACTGAGCCTGGGAGG - Intergenic
944277193 2:197852240-197852262 GAGGGAGCAGGGAGGATGGTGGG + Intronic
944684133 2:202103142-202103164 GAGGGAGAGCCTGGGATGGGGGG + Intronic
944971422 2:204997100-204997122 GAATGACAACTGAGGAGGGGAGG - Intronic
945701536 2:213176827-213176849 GACTGAGAACTGGGGATAGGAGG + Intergenic
946119083 2:217493411-217493433 GAGGGTGAATGGAGGGTGGGAGG - Intronic
946716121 2:222556644-222556666 GGGGGAGGAGTGAGGGTGGGTGG - Intronic
946758944 2:222974118-222974140 GTGGGAGAGCTGAGGAGGGCAGG - Intergenic
947064397 2:226205543-226205565 GAGGGAGAAAGGATGATGGAGGG + Intergenic
947190898 2:227503553-227503575 GAGGGAGAAATGAGGAAGGAAGG - Intronic
947265549 2:228275614-228275636 GAGGGAGGAGTGAGGAAGTGGGG - Intergenic
947728120 2:232412912-232412934 GAGGGAGAACTCAGGACAGGTGG + Intergenic
947792481 2:232876151-232876173 GAGGGAGAAATTAGGAGGGGCGG + Intronic
947894041 2:233652115-233652137 TCTGGAGAACTGGGGATGGGAGG + Intronic
948035599 2:234855924-234855946 GAGGGAGAATGGAGGCTGGGAGG - Intergenic
948398966 2:237668613-237668635 GAGGGGGAACTGAGGCTGGAAGG - Intronic
948716982 2:239871482-239871504 GAGGGAGATGGGGGGATGGGGGG - Intergenic
948974713 2:241457253-241457275 GAGGGAGAAATGAGGAAGGTGGG - Intronic
1168733548 20:109458-109480 GAGGGAGGAGGGAGGAAGGGGGG + Intergenic
1168906466 20:1407878-1407900 CAGGGACAACTTAGGATGAGGGG + Intergenic
1169246357 20:4028251-4028273 GAGGGAGAAGGAAGGAAGGGAGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169275287 20:4229707-4229729 GAGGGCGCATTGAGGGTGGGTGG - Intronic
1170973855 20:21141931-21141953 GAGGGAGAAATGGGGATGGCAGG - Intronic
1171198104 20:23217280-23217302 GAGTGAGAACAGAGGATGTTTGG + Intergenic
1171272366 20:23826875-23826897 CAGGGAGAACTTAGGCAGGGAGG - Intergenic
1172204552 20:33153752-33153774 GATGGAGAACAAAGGAAGGGAGG + Intergenic
1172463306 20:35136416-35136438 GGGGGAGAGCTGAGGATAGCGGG - Intronic
1172697940 20:36835291-36835313 GAGGGAGAGCTGGGGGTTGGGGG + Intronic
1172758621 20:37306123-37306145 GGGGCAGAAGTGAGGGTGGGAGG + Intronic
1172836949 20:37879207-37879229 GAGGCAGGGCTGAGGGTGGGCGG - Intergenic
1173341257 20:42154843-42154865 GTGGGAGAACTGGAGCTGGGGGG + Intronic
1173438992 20:43058426-43058448 GAGAGAGAAAAGAGGATGGAAGG + Intronic
1173443330 20:43096587-43096609 CAGGCAGAGCTGTGGATGGGGGG - Intronic
1173855025 20:46244714-46244736 GAGGGAGAAAAGGGGAAGGGGGG + Intronic
1173856808 20:46255556-46255578 GAGGGAGAGGTGAGGATGGGAGG - Intronic
1174042714 20:47711197-47711219 AAGGGAGAACTGATGCTGGGAGG - Intronic
1174136362 20:48382781-48382803 GAGAAAGGACTGTGGATGGGAGG + Intergenic
1174280726 20:49437294-49437316 GAGGGAGAACTGATGGGGGCTGG + Intronic
1174432027 20:50477293-50477315 GAGGGAGACCTGGGGATTGGAGG - Intergenic
1174554222 20:51382533-51382555 GAGGGAAGACTGAGGATGTGGGG + Intergenic
1174931855 20:54824797-54824819 GAGGGAAAGGTGAGGAAGGGAGG + Intergenic
1175596385 20:60238043-60238065 GCTGGAGAATTGAGGCTGGGAGG + Intergenic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1175799109 20:61790958-61790980 GTGAGAGCACTGAGGATGGATGG - Intronic
1176116530 20:63434062-63434084 GAGGGTAAACTGAGGCTGTGGGG - Intronic
1176157460 20:63628836-63628858 GAGGGGGGCCTGGGGATGGGAGG + Intergenic
1176240555 20:64073905-64073927 GTGGGAGAGCTGAGGAAGCGGGG + Exonic
1176242389 20:64081087-64081109 GGGGGAGGGCTGAGGAGGGGAGG + Intronic
1176621777 21:9066125-9066147 GATGGAGAGCTGAGTGTGGGGGG - Intergenic
1176672759 21:9750232-9750254 CTTGGAGAACAGAGGATGGGTGG - Intergenic
1176949718 21:15030710-15030732 GAGGGAGAGAGGAGGATAGGTGG + Intronic
1177274654 21:18893827-18893849 CAGGTAGAACTGAGAATGTGGGG + Intergenic
1178893100 21:36536310-36536332 GAGGGAGAACTGAGGATGGGTGG - Intronic
1179030022 21:37712453-37712475 GAGGGAGAGAGGAGGAGGGGAGG - Intronic
1179030070 21:37712601-37712623 GAGGGAGAGAGGAGGAGGGGAGG - Intronic
1179421801 21:41242228-41242250 GAGGGACAAGTGAGGAGCGGTGG + Intronic
1179587564 21:42383377-42383399 TGGGGAGACCTGAGGATGGTGGG + Intronic
1179834935 21:44024836-44024858 GATGGAGTACTCAGGAAGGGAGG - Intronic
1180140906 21:45892945-45892967 GAGGGAGTCCTGGGGAGGGGAGG + Intronic
1180182475 21:46124163-46124185 GTGGGTGGACAGAGGATGGGTGG + Intronic
1181172172 22:21015855-21015877 GGGGGAGAACTGAGCATGTAGGG + Intronic
1181177821 22:21047714-21047736 CAGGGAGAGCTGGGGGTGGGGGG + Intronic
1181537193 22:23552592-23552614 GAGGTAGAAGAGAGGATGGATGG - Intergenic
1182074103 22:27483274-27483296 AAGGGAAAACTGAGGCTGTGAGG - Intergenic
1182218997 22:28742836-28742858 GAGGGAAAAGTGAGAATTGGAGG + Intronic
1182673637 22:32019221-32019243 AAGGGAGTTCTGTGGATGGGTGG - Intergenic
1182709194 22:32310065-32310087 GAGGGAGGACGGGGGATGGGGGG + Intergenic
1182797243 22:32999926-32999948 GAAGGTGAACTCAAGATGGGAGG + Intronic
1182890955 22:33818446-33818468 GAGGGAGAAAAGAGGAGGGGAGG + Intronic
1182991307 22:34770587-34770609 GAGGAAGAAATGAGGGTTGGTGG - Intergenic
1183064473 22:35353586-35353608 GTGGGTGAACTGAGGAATGGGGG + Intergenic
1183263052 22:36808426-36808448 GAGCTAGAACTGAGGCTCGGTGG - Intronic
1183303908 22:37071871-37071893 TAGGGAGATCAGTGGATGGGTGG + Intronic
1183639676 22:39085241-39085263 CAGGGAGAAGTGGGGATGAGGGG - Intronic
1184158063 22:42681875-42681897 GAGAGAGAAGGGAGGAAGGGAGG - Intergenic
1184169790 22:42752120-42752142 GTGGGAGACCTCAGGGTGGGGGG + Intergenic
1184200064 22:42962553-42962575 AAGGCAGAACTGGGGGTGGGGGG + Intronic
1184403735 22:44288179-44288201 GATGGAAAACTGAGGCTCGGTGG + Intronic
1184414359 22:44343627-44343649 GAGGGAGCAGTGAGGAAGGTTGG + Intergenic
1184717946 22:46292610-46292632 TGGGGAGAGGTGAGGATGGGAGG - Intronic
1184852372 22:47128124-47128146 GAGGGAGGATGGGGGATGGGTGG - Intronic
1184852385 22:47128151-47128173 GAGGGAGGATGGGGGATGGGTGG - Intronic
1184852398 22:47128178-47128200 GAGGGAGGATGGGGGATGGGTGG - Intronic
1185295234 22:50049810-50049832 GAGGGACAGCTGAGGCCGGGCGG + Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949768213 3:7550334-7550356 GAGGGAGAAGGGAGGAGGGAAGG - Intronic
950332578 3:12168256-12168278 GAGGGAGCAGTGGGAATGGGAGG + Intronic
950687893 3:14631903-14631925 GAGGGAGAGAAGAGGAAGGGAGG + Intergenic
950768835 3:15294427-15294449 GAGGAAGAAAGGAGGATGGAAGG - Intronic
952559384 3:34572910-34572932 GCTGGTGAACTGAAGATGGGTGG + Intergenic
953078239 3:39591470-39591492 GATGGACATCTGAGGAGGGGTGG - Intergenic
953414351 3:42707146-42707168 GAGGGTGATCTGAGTATGAGGGG - Intronic
953564642 3:44021413-44021435 GAGGGAGAAAGGAGGAAGGGGGG - Intergenic
953849569 3:46455504-46455526 CACGGAGACCTCAGGATGGGAGG - Intronic
955187852 3:56732273-56732295 GATGGAGAAGTGAGGCTGGGTGG - Exonic
955395661 3:58555512-58555534 GAGGGAGACCTGAGGATCCCTGG + Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956838149 3:73112662-73112684 GAGGCAGATCTGGGGGTGGGAGG - Intergenic
957334237 3:78806390-78806412 AATGGAGAACTGAGGGTGAGGGG + Intronic
957511900 3:81200353-81200375 AAGGGATAATTGAGGATGGCTGG - Intergenic
958975959 3:100668079-100668101 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
959133150 3:102383480-102383502 GAGGGAGCAATTAGAATGGGTGG - Intronic
959539361 3:107523115-107523137 CAGGGAGGGCTGGGGATGGGGGG - Intronic
961053573 3:123767714-123767736 GGGGAAGAAGTAAGGATGGGTGG + Intronic
961340088 3:126212140-126212162 GAGGGGGAAGGGAGGAAGGGAGG + Intergenic
961340186 3:126212507-126212529 GAGGAAGGAATGAGGAAGGGAGG + Intergenic
962279447 3:134039106-134039128 AAGGGAGAACTGACGCTGCGTGG - Intronic
962926804 3:140001263-140001285 GAGAGAGAAAAAAGGATGGGAGG - Intronic
964816171 3:160719871-160719893 GAGGGAACAGTGTGGATGGGTGG - Intergenic
964896552 3:161603598-161603620 GAGGGAGGAGGGAGGAGGGGGGG - Intergenic
966242903 3:177774699-177774721 GAGGGGGAAAGGAGGAAGGGAGG - Intergenic
966358068 3:179103386-179103408 GATGGAGAATTGGGGAGGGGGGG + Intergenic
968583493 4:1405585-1405607 GAGGGAGAAAGGAGGGAGGGAGG + Intronic
968614972 4:1573660-1573682 GAGGGGGAGCTGAGGATGGGGGG - Intergenic
968614979 4:1573677-1573699 GAGGGGGAGCTGAGGATGAGGGG - Intergenic
968614995 4:1573744-1573766 GAGGGGGAGCTGAGGATGGGGGG - Intergenic
968669702 4:1842509-1842531 GAGGCAGCACTGTGGATGAGAGG - Intronic
968724186 4:2234512-2234534 GATGGAGAACAGAGGAAAGGTGG - Intronic
968792146 4:2672891-2672913 GATGGAGCACTGGGGAGGGGAGG + Intronic
968922862 4:3531728-3531750 GAGCGAGAAATGAGGAGGTGAGG - Intronic
969525199 4:7700738-7700760 GAGGGAGCACAGAGCATTGGGGG + Intronic
969525293 4:7701172-7701194 GAAGGAGAAAGGAGGAAGGGAGG + Intronic
969540318 4:7784523-7784545 GAGAGAGGACTGAGGAGGGAAGG + Intronic
969581109 4:8065996-8066018 GAGGGAGAAAGGAGGGAGGGAGG + Intronic
970872313 4:20830024-20830046 AAAGGAGAACTGAGGGAGGGAGG - Intronic
970903700 4:21190509-21190531 GGGGGGGCACTGAGGGTGGGAGG + Intronic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
972606516 4:40618977-40618999 GAGGAAGGACTGAGGATGGGGGG - Intronic
972772784 4:42213730-42213752 GAGGGAGAAGAGAGGGAGGGGGG - Intergenic
974633149 4:64522086-64522108 TGGGGAGAACAGAGGATGAGGGG - Intergenic
975054924 4:69918269-69918291 GAGGGTGAGCTGAGGAAGTGAGG - Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
976327416 4:83787749-83787771 GAGGAAGAACTGGGGAAGGATGG + Intergenic
976815886 4:89148384-89148406 GAGGGGGCACTGAGGATGGCTGG - Intergenic
977152706 4:93533351-93533373 GAGAGAGAAGTAAGGAAGGGAGG - Intronic
977157699 4:93594403-93594425 GCTGGAGATCTGAGAATGGGCGG - Intronic
977542840 4:98338997-98339019 GAGGGAGTAAGGAGAATGGGAGG - Intronic
978389801 4:108213568-108213590 GAGGGAGTGCTGAGGACGGAGGG + Intergenic
979468479 4:121069803-121069825 GAGGGACAACTGGGAATGAGGGG - Intronic
979505529 4:121491419-121491441 GAGGGAGGAATGAGGAAGGAAGG - Intergenic
979520105 4:121656108-121656130 GAGGGAGGACGGGGGATGAGGGG + Intergenic
981912272 4:149995452-149995474 GAGGGGGAAGGGAGGAAGGGAGG + Intergenic
982197370 4:152929854-152929876 GAGGGAGAAATGAAGATGTGTGG + Intergenic
982509309 4:156261637-156261659 GAGGGAGAAGAGAGGAGAGGAGG - Intergenic
982730151 4:158947040-158947062 GAAGGAGAGCTGAGGGAGGGAGG + Intronic
983191231 4:164755527-164755549 GAGGGAGAGGAGAGGAGGGGAGG + Intergenic
985401956 4:189601593-189601615 CTTGGAGAACAGAGGATGGGTGG + Intergenic
986536466 5:8793375-8793397 AAAAGAGAACTGAGGATGGCTGG + Intergenic
987396567 5:17430261-17430283 GAGGGACAACTGAGGAGGCAGGG + Intergenic
987556396 5:19456677-19456699 GAGAGAGAACTGATGATCGAAGG + Intergenic
987711915 5:21511600-21511622 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
988050363 5:26021559-26021581 AAGGAAGAAAAGAGGATGGGAGG + Intergenic
988302495 5:29449183-29449205 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
988552621 5:32210328-32210350 GAGGGTGAATGAAGGATGGGTGG + Intergenic
988681750 5:33490216-33490238 GAGGGGGAACTGAGGATTATGGG + Intergenic
989304450 5:39936531-39936553 GAGAAAGAACAGAGGATGGCTGG + Intergenic
989606560 5:43249517-43249539 GATGTAGAACTGAAGATGGAAGG + Intronic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
991092869 5:62709994-62710016 GAGGGGGAAGTGAGGAAGAGAGG - Intergenic
991693150 5:69245259-69245281 GAGGGAGGACGGGGGAGGGGAGG - Intronic
991762275 5:69930739-69930761 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
991785052 5:70187366-70187388 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
991841503 5:70805788-70805810 TAGTGGGAGCTGAGGATGGGTGG - Intergenic
991877499 5:71187758-71187780 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
991994698 5:72375686-72375708 GCAGGAGAACTGAGGACAGGAGG - Intergenic
992123817 5:73621450-73621472 GCGGGAGGACTGAGGATTGCTGG + Intergenic
992542442 5:77778324-77778346 GAGGCAGAATTGGGGATTGGGGG - Intronic
992778272 5:80106480-80106502 GAAGGGGAACAGAGGAAGGGAGG + Intergenic
993081189 5:83302486-83302508 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
995238802 5:109861775-109861797 GAGGGAGCACTGAAAATGTGAGG + Intronic
996163285 5:120194177-120194199 GAGGGAGAAGAGAGGAAGGGTGG + Intergenic
996200952 5:120672383-120672405 GAGTGTGGAGTGAGGATGGGTGG + Intronic
996230020 5:121051600-121051622 GAAGGAGAGCTGAGGATTGCAGG + Intergenic
996299833 5:121967978-121968000 GAGGTAGAAAAGAAGATGGGTGG - Intronic
996771969 5:127095642-127095664 GAGGCAGAACTGGGGAGGGCAGG - Intergenic
996836689 5:127801454-127801476 GAGGGAGAAGAGAAGATGAGGGG - Intergenic
997227919 5:132223239-132223261 GAGGTATAAAGGAGGATGGGAGG - Intronic
997574568 5:134964309-134964331 CATGGGGAACTGAGGAAGGGAGG - Intronic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
997902123 5:137776518-137776540 GAGGGAGAAATGAGGAGTGATGG + Intergenic
998171274 5:139873241-139873263 GAGGGAGACCTCAGCAGGGGTGG - Intronic
998224679 5:140317576-140317598 GAAGGAGAACTGAGAATCAGAGG - Intergenic
998527144 5:142853026-142853048 GAGGAAGTACTGATGAGGGGAGG + Intronic
999236213 5:150097322-150097344 GAAGGAGAAGGGAGGAAGGGAGG + Intronic
999323238 5:150627311-150627333 GAGGGTCAACTGGGGAAGGGTGG + Intronic
999872334 5:155765427-155765449 GAGGGAGGAGGGAGGGTGGGAGG + Intergenic
1000732832 5:164857378-164857400 GAGGAAGAACAGAGGATCTGAGG - Intergenic
1000947597 5:167440712-167440734 GAAAGAGAAGAGAGGATGGGGGG - Intronic
1001234716 5:170019881-170019903 GAGGTAAAACTGAGGATGTGGGG - Intronic
1001551096 5:172602870-172602892 GAGGGAGAAGGGAGGAGGGGAGG - Intergenic
1001804358 5:174570699-174570721 GTGGGAGTGCTGAGGATGTGAGG + Intergenic
1001856683 5:175017650-175017672 GATGGAGAAATGAAGATGGTAGG + Intergenic
1001959726 5:175872634-175872656 GAGGGGCAGCGGAGGATGGGAGG - Intronic
1003296962 6:4838385-4838407 GAGTGAGAACTTAGGATGTTTGG + Intronic
1003320792 6:5049270-5049292 AATTGAGAGCTGAGGATGGGCGG + Intergenic
1003551000 6:7101853-7101875 GAGGGGGAACGAGGGATGGGGGG - Intergenic
1004649325 6:17593489-17593511 GAGGGAGAAGGGAGGGAGGGAGG - Intergenic
1004651583 6:17614625-17614647 GCGGGAGAACTGGGGGGGGGGGG + Intergenic
1005510250 6:26506169-26506191 GAAGGAGAAGTGAGTATGGGTGG - Intronic
1005825189 6:29628042-29628064 GAGGGAGATGTGGGGCTGGGAGG + Intronic
1005982662 6:30848295-30848317 AAGAGAGAACTCACGATGGGAGG - Intergenic
1006296910 6:33173814-33173836 GAGGGAGAGCTGGGGCTGAGTGG + Intronic
1006480962 6:34293849-34293871 GGGAGAGGACTGTGGATGGGTGG + Intronic
1006734397 6:36262270-36262292 GTGGGAGAGTGGAGGATGGGAGG - Intronic
1006749345 6:36366822-36366844 GAAGCAGAACTGGGGTTGGGTGG - Intronic
1006971590 6:38050935-38050957 GAAGGAGACCTGAAGATTGGTGG + Intronic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008574601 6:52848176-52848198 GAGCGAGAAATGAAGATGAGAGG + Intronic
1009005789 6:57785088-57785110 TAGTGGGAGCTGAGGATGGGTGG + Intergenic
1011151201 6:84275332-84275354 TAGGGAGAACTGAGAGTGGAGGG + Intergenic
1012231185 6:96762636-96762658 GAGGGAGGACTGAGGGTAGCTGG - Intergenic
1013039948 6:106423670-106423692 GAGGGAGAACTGAGGACTGGAGG - Intergenic
1013531324 6:111021480-111021502 TGGGGAGCATTGAGGATGGGAGG + Intronic
1013535380 6:111058873-111058895 TAGAGAGAACTTAGAATGGGAGG - Intergenic
1013754214 6:113441820-113441842 GAGGGAGGACTGGGGGAGGGAGG + Intergenic
1014015641 6:116527067-116527089 GAGGGACAATTGAGGCTGAGAGG + Intronic
1014998159 6:128179022-128179044 GTGGTAGAACTGAGGCTGGCAGG - Intronic
1015564249 6:134550998-134551020 GAGGGAGGAATCAGGAGGGGAGG - Intergenic
1015837277 6:137433991-137434013 AAGGGAGAAGGGAGGGTGGGAGG - Intergenic
1016093599 6:140009078-140009100 AATGGAGAACTGAGGAAGGAGGG + Intergenic
1016176176 6:141080283-141080305 GAGAGGGAACTGGGGGTGGGTGG + Intergenic
1016387582 6:143543495-143543517 GGGGGAGAACCTAGGATGGTCGG + Intronic
1016899885 6:149090989-149091011 CAAGGAGAACTGAGGATGGGAGG - Intergenic
1018234126 6:161706106-161706128 TAGGTAGAATTGAGGATGTGGGG - Intronic
1018445553 6:163854951-163854973 GAGGGGGAAAAGAGGAAGGGAGG + Intergenic
1018639044 6:165890024-165890046 GAGGGAGGAGTGAGGGAGGGAGG - Intronic
1019315528 7:382551-382573 AAGGGAGAAGTGAGGGAGGGAGG + Intergenic
1019483512 7:1277103-1277125 GAGGGAGAAGGGAGGTAGGGAGG - Intergenic
1019483520 7:1277125-1277147 GAGGGAGAAGGGAGGTAGGGAGG - Intergenic
1019483528 7:1277147-1277169 GAGGGAGAAGGGAGGTAGGGAGG - Intergenic
1019906883 7:4071558-4071580 CAGGGGGAACTGAGCAGGGGAGG + Intronic
1019959398 7:4446331-4446353 AAGGGAGGACAAAGGATGGGGGG + Intergenic
1021071607 7:16248734-16248756 GAGGGCGAGCTGAAGAAGGGTGG + Intronic
1021249788 7:18310147-18310169 GAGGGAGGACTGTGGTGGGGGGG + Intronic
1021417382 7:20403790-20403812 GAGGGAGAAAAGAGGAAGGTTGG + Intronic
1021853342 7:24830081-24830103 GAGGTAGAACTGAGGTAGGACGG + Intronic
1022035659 7:26531709-26531731 GAGGGAGAATGGAGGGTGGTGGG + Intergenic
1022452592 7:30528842-30528864 GAGGGAGAAGGAAGGAAGGGAGG + Intronic
1022616456 7:31935895-31935917 GAGTGGGAACTGGGGAGGGGTGG + Intronic
1023156914 7:37260559-37260581 GAGGGAGAACTGGGCAGGGAGGG - Intronic
1023483735 7:40662317-40662339 GGAGGAGAACAGAGGATGTGAGG - Intronic
1023533408 7:41183028-41183050 GAGGGAGAGGAGGGGATGGGAGG - Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025190289 7:56891103-56891125 GAGAGAGAAATGAGGGAGGGAGG - Intergenic
1025681650 7:63685817-63685839 GAGAGAGAAATGAGGGAGGGAGG + Intergenic
1025911478 7:65832264-65832286 GAGGGAGGACAGGGGAGGGGAGG + Intergenic
1026135677 7:67658448-67658470 GGGGATGAAATGAGGATGGGAGG + Intergenic
1026229923 7:68473667-68473689 TATGCAGAACTGAGGATTGGAGG - Intergenic
1028462621 7:91112870-91112892 GAGAGAGAACAGGGGAAGGGGGG + Intronic
1028648122 7:93120714-93120736 GAGGGTGAGCTGAAGCTGGGTGG + Intergenic
1028648963 7:93129132-93129154 GAGGGACAACTCAAGAAGGGAGG - Intergenic
1029037896 7:97541253-97541275 GAGGGAGAGGTGTGGGTGGGTGG + Intergenic
1030085984 7:105816099-105816121 GGAGGAGAAGTGAGGGTGGGTGG + Intronic
1032339119 7:131054538-131054560 GAGGGAGGAGGGAGGAAGGGAGG + Intergenic
1033036384 7:137879774-137879796 GAGGCAGAACTATGGATGTGTGG + Exonic
1033150848 7:138913908-138913930 GAGGGAGAAATGAGGAAAGAGGG + Intronic
1033385360 7:140869063-140869085 GAAGGAACACTGAGGTTGGGAGG + Intronic
1033943257 7:146681541-146681563 GAGGGAGATGGGAGGGTGGGGGG + Intronic
1034183409 7:149156079-149156101 GGGGAAGAACTGAAGAAGGGAGG + Intronic
1034566739 7:151921585-151921607 GAGGGAGAAATGAGCAAGGGAGG + Intergenic
1034878788 7:154748403-154748425 AGGAGAGAACGGAGGATGGGAGG - Intronic
1035083463 7:156236564-156236586 GAGGGACGACTGAGGATGCTTGG - Intergenic
1035776352 8:2191408-2191430 GAGGGGGAAGGGAGGAAGGGAGG - Intergenic
1036126588 8:6068575-6068597 GAGGAAGAAAGAAGGATGGGAGG - Intergenic
1036210245 8:6835186-6835208 GGGGGGGAACCGAGCATGGGTGG + Intronic
1036723458 8:11200128-11200150 GAGGGAGAACGGGGGAAGAGGGG + Intronic
1037524123 8:19708111-19708133 GAGGGGGAACTGAGAACGGGAGG + Intronic
1037785813 8:21902491-21902513 GAGGGTGAACTGAGGCTTTGCGG - Intergenic
1038409105 8:27344402-27344424 GCAGGAAAGCTGAGGATGGGAGG - Intronic
1038989154 8:32847017-32847039 GAAGGAGAACTGAGGAAAGGGGG + Intergenic
1039870266 8:41540034-41540056 CTGGGACACCTGAGGATGGGTGG - Intronic
1040354929 8:46608294-46608316 GAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1043280540 8:78460392-78460414 AATGGAGAACTGAGGCAGGGAGG + Intergenic
1044225931 8:89718116-89718138 GAGAGACAACTGGGGGTGGGGGG - Intergenic
1044353812 8:91197191-91197213 GCTGGAGATCTGAGAATGGGCGG - Intronic
1044653253 8:94521197-94521219 GAAGGAGAACAGAGGGTTGGGGG - Intronic
1044711517 8:95063043-95063065 GAGGAAGAAGTGAGGCTGGAAGG + Intronic
1044821947 8:96160885-96160907 GAGGGAGGGCAGAGGAGGGGTGG + Intergenic
1044897327 8:96906238-96906260 GAGGGAAAACTAAGGCTGAGAGG - Intronic
1045405337 8:101860737-101860759 GAGGGAGAGCTGCGGAATGGGGG + Intronic
1045755177 8:105533912-105533934 GAGGGAGAAAGGAAGAAGGGAGG - Intronic
1045789389 8:105964143-105964165 GAGGGAGAAGGAAGGAAGGGAGG + Intergenic
1045975185 8:108123321-108123343 GAGGGAGAGCTGAAGCAGGGTGG - Intergenic
1046097788 8:109580822-109580844 GAGGGAGGAGTGAGGAGTGGTGG - Intronic
1046145944 8:110158618-110158640 GAGGGAGGAGAGAGGAGGGGAGG - Intergenic
1046872551 8:119219844-119219866 GAGGCATAACTGAGCAGGGGTGG + Intronic
1046877838 8:119276085-119276107 AATGGAGAACTGACCATGGGAGG + Intergenic
1047608508 8:126497842-126497864 GAGGGAGTACAAAGGATGTGAGG + Intergenic
1047827021 8:128587871-128587893 TTGTGAGAAATGAGGATGGGTGG - Intergenic
1048003924 8:130402852-130402874 GAGGGAGAAATGGTGATGAGGGG - Intronic
1048690294 8:136955669-136955691 GAGGAAGAAGGGAGGGTGGGAGG - Intergenic
1050122408 9:2321080-2321102 GAGGGGGAGATGAGGAAGGGAGG + Intergenic
1050670841 9:7995663-7995685 GAGAGAGAGCTGAGGGTGAGTGG - Intergenic
1050740407 9:8813244-8813266 GAGGAAGCATTGAGGAAGGGCGG + Intronic
1051650793 9:19322428-19322450 GAGAAAGAAGTGAAGATGGGAGG + Intronic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1053003331 9:34589755-34589777 GAGGGAGGGAGGAGGATGGGGGG - Intronic
1053893856 9:42724310-42724332 CAGGGAGACCTGAGGAGAGGGGG - Intergenic
1055283925 9:74707540-74707562 GAGGGTCATCTGAGCATGGGAGG - Intergenic
1055332654 9:75199748-75199770 CAGGTAGAATTGAGGATAGGAGG - Intergenic
1057032293 9:91785131-91785153 GAGGGAGAGATGAGGAGTGGAGG - Intronic
1057217139 9:93235318-93235340 GTGTGAGCACTGGGGATGGGTGG - Intronic
1057222021 9:93262583-93262605 GAGGGAGAGCTGACTATGCGTGG + Intronic
1058354752 9:104071156-104071178 GAGGGAGAGAGGAGGATGGAAGG + Intergenic
1058603638 9:106697697-106697719 GAGGGAGATCAAGGGATGGGAGG - Intergenic
1059476089 9:114548873-114548895 GAGAGAGAAGGGAGGAAGGGAGG + Intergenic
1059630475 9:116116481-116116503 GAGGGAGAACAATGGTTGGGTGG + Intergenic
1059982896 9:119792711-119792733 AAGAGAAAACTGAGGTTGGGAGG + Intergenic
1061432556 9:130540457-130540479 GAGAGAGAAGGGAGGAAGGGAGG + Intergenic
1061477169 9:130875817-130875839 GAAGGAGAAGAGAGGAGGGGAGG - Intronic
1061484520 9:130913653-130913675 CAGGGAGATCTGAGGAGCGGTGG + Intronic
1061495393 9:130971041-130971063 GAGGAAGAAAGGAGGAAGGGAGG + Intergenic
1061495406 9:130971074-130971096 GAGGGAGGAGGGAGGAAGGGAGG + Intergenic
1061820742 9:133226040-133226062 GAGGGAGGAGGGAGGGTGGGTGG + Intergenic
1061826422 9:133261024-133261046 AAGGGAGAGTTGAGGATGGCTGG + Intronic
1062391657 9:136336317-136336339 GCGGCAGAACTGAGGGTGGAAGG - Intronic
1062407158 9:136402325-136402347 GAGGGAGCCCTGAGCATCGGCGG + Exonic
1062449177 9:136608356-136608378 GAGGGAGAGAGGAGGAAGGGAGG + Intergenic
1062527374 9:136983421-136983443 GATGCAGAACTGAGGGAGGGGGG - Exonic
1203489268 Un_GL000224v1:87808-87830 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1203501889 Un_KI270741v1:29703-29725 GAGAGAGAACTGAGTGTGGCTGG - Intergenic
1185692355 X:2166239-2166261 GAGGGAGAACATAGGATGATAGG - Intergenic
1185692380 X:2166853-2166875 GAGGGAGAACAAAGGATGTTTGG - Intergenic
1185842252 X:3402772-3402794 GAGGAATACCTGAGGCTGGGTGG - Intergenic
1185998233 X:4977683-4977705 CTGGGAGAACTGAGGGTGTGAGG + Intergenic
1186225973 X:7399521-7399543 GAAGGAGTAGTGGGGATGGGTGG + Intergenic
1186624330 X:11276110-11276132 GAGGGAGGAAAGAGGAGGGGTGG + Intronic
1187825542 X:23331945-23331967 GAGGGCGAACCGAGGTTGGAAGG + Intergenic
1188998200 X:36911973-36911995 GAGGAAGAAGTGAGGGTGTGAGG + Intergenic
1189180937 X:39004004-39004026 GAGGTGGGACTGAGGAGGGGTGG + Intergenic
1189497820 X:41525395-41525417 GAAGGGGAAGAGAGGATGGGAGG - Intronic
1190259023 X:48786513-48786535 GAGGGAGAAGGGAGGGAGGGAGG + Intergenic
1190319663 X:49172534-49172556 GAGGAAGAACTGGCGAAGGGCGG - Intronic
1190439492 X:50463272-50463294 GAGAGAGGAAGGAGGATGGGGGG - Intronic
1190526339 X:51332779-51332801 GAGGGAGAGATGAAGCTGGGCGG - Intronic
1190542901 X:51496613-51496635 GAGGGAGAGATGAAGCTGGGCGG + Intergenic
1190594714 X:52041425-52041447 GAGGGAGAACTTCACATGGGTGG - Intergenic
1190614110 X:52212648-52212670 GAGGGAGAACTTCACATGGGTGG + Intergenic
1190757373 X:53412666-53412688 GAGGGAGAACTCAAAAGGGGTGG - Intronic
1191080243 X:56503460-56503482 GGGGGATCACGGAGGATGGGAGG + Intergenic
1191791424 X:64976179-64976201 GCCGGAGAGGTGAGGATGGGAGG - Intronic
1191956073 X:66643638-66643660 GAGGGACAATGGAGGGTGGGAGG - Intergenic
1192368305 X:70493521-70493543 GAAGGGCAACTGAGGATGAGAGG - Intronic
1192398980 X:70815414-70815436 GAGGGAAAACCATGGATGGGGGG - Intronic
1192405292 X:70879117-70879139 GAGGGAGGGAAGAGGATGGGAGG + Intronic
1192973804 X:76261477-76261499 GAGGGTGAACTGAGGCAAGGCGG - Intergenic
1193900389 X:87168847-87168869 GAGTAAGAATTGGGGATGGGGGG + Intergenic
1194208586 X:91040470-91040492 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1194721554 X:97346391-97346413 GAGGGAGAAGAGAGGATGAAGGG - Intronic
1195297035 X:103489404-103489426 GAGGTGGAACTGAGTCTGGGTGG - Intergenic
1196167513 X:112551732-112551754 GAGGGAGAACTGAAGCAGAGTGG - Intergenic
1196893510 X:120311472-120311494 GAGGGAGAAGAGTGGAAGGGAGG - Intronic
1197186252 X:123590485-123590507 AAGGAAGCACAGAGGATGGGTGG - Intergenic
1197214891 X:123858907-123858929 GCAGGAAAACTGAGGATAGGCGG + Intergenic
1198206543 X:134471008-134471030 GAGGGAGTAAGGAGGAAGGGTGG - Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1199529111 X:148826947-148826969 GAGGGGTATCTGTGGATGGGGGG + Intronic
1199616063 X:149657093-149657115 GAGAGAGAACCGAGGATGTCTGG - Intergenic
1199626577 X:149746155-149746177 GAGAGAGAACCGAGGATGTCTGG + Intergenic
1200123568 X:153802697-153802719 GAGGGAGGGCTGGGGATGGATGG - Exonic
1200481144 Y:3704221-3704243 GAGGGAGAAGAGAGTGTGGGGGG - Intergenic
1201158295 Y:11151578-11151600 GATGGAGAGCTGAGTGTGGGGGG - Intergenic
1201298486 Y:12485997-12486019 GAGGGAGAAAAGAGGAAGTGAGG - Intergenic
1201647753 Y:16254114-16254136 AAGGGAGAGGTGAGGAGGGGAGG + Intergenic
1201655058 Y:16331183-16331205 AAGGGAGAGGTGAGGAGGGGAGG - Intergenic
1202055545 Y:20826343-20826365 GCTGGAGATCTGAGAATGGGCGG - Intergenic
1202370466 Y:24192459-24192481 GAGGGAGAAGTGGGGATAGGTGG - Intergenic
1202500318 Y:25477658-25477680 GAGGGAGAAGTGGGGATAGGTGG + Intergenic