ID: 1178897156

View in Genome Browser
Species Human (GRCh38)
Location 21:36568389-36568411
Sequence GGAGGCACGAAGTCCCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1178897149_1178897156 -1 Left 1178897149 21:36568367-36568389 CCAGCCAACCCCTGAGCAATAAG 0: 1
1: 0
2: 1
3: 6
4: 114
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1178897153_1178897156 -9 Left 1178897153 21:36568375-36568397 CCCCTGAGCAATAAGGAGGCACG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1178897147_1178897156 1 Left 1178897147 21:36568365-36568387 CCCCAGCCAACCCCTGAGCAATA 0: 1
1: 0
2: 2
3: 13
4: 178
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1178897151_1178897156 -5 Left 1178897151 21:36568371-36568393 CCAACCCCTGAGCAATAAGGAGG 0: 1
1: 0
2: 0
3: 19
4: 134
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1178897148_1178897156 0 Left 1178897148 21:36568366-36568388 CCCAGCCAACCCCTGAGCAATAA 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1178897146_1178897156 27 Left 1178897146 21:36568339-36568361 CCAAGGTCATGCTGATTTCAGCA 0: 1
1: 0
2: 4
3: 22
4: 220
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150
1178897154_1178897156 -10 Left 1178897154 21:36568376-36568398 CCCTGAGCAATAAGGAGGCACGA 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1178897156 Original CRISPR GGAGGCACGAAGTCCCAGCT AGG Intronic
900346518 1:2213016-2213038 GGAGGCACGGAGTTCCGGCCTGG - Intergenic
900717404 1:4153728-4153750 GGAGGCTGGAAGTCCAAGGTTGG + Intergenic
901010532 1:6199320-6199342 GGAGGCCCGGGGCCCCAGCTAGG - Intronic
902242213 1:15096616-15096638 GGAGGCTGGAAGTCCAAGATCGG + Intronic
906460475 1:46032258-46032280 GCTGGCAAGAAGTCCCTGCTTGG - Exonic
907617404 1:55938723-55938745 GGAGGCACGAGCTGCCAGCCAGG - Intergenic
910669673 1:89760719-89760741 GGAGGCTGGAAGTCCAAGATTGG - Intronic
911267078 1:95754612-95754634 GCAGGCACGAAATCCAGGCTGGG + Intergenic
911794535 1:102059076-102059098 GGTGGCTGGAAGCCCCAGCTGGG - Intergenic
914751823 1:150539875-150539897 GCAGGCACGAAGGCCCGGCACGG + Intergenic
915506995 1:156364087-156364109 GGAGGCTGGAAGTCCAAGATCGG + Intronic
922770403 1:228179009-228179031 GGAGGCGCGCACACCCAGCTGGG + Exonic
1069634431 10:69916873-69916895 TGAGGCAAGAAGTCCCAGGCAGG + Intronic
1069834139 10:71297964-71297986 GAAGGCATAAGGTCCCAGCTGGG - Exonic
1072829406 10:98641769-98641791 AAAGACACAAAGTCCCAGCTGGG - Intronic
1073766100 10:106684548-106684570 AGAGGAAAGAAATCCCAGCTGGG + Intronic
1073808703 10:107128683-107128705 GGATTAATGAAGTCCCAGCTAGG - Intronic
1074165844 10:110872559-110872581 GGACCCCCGAAGTCCCAGCCCGG - Intronic
1075945855 10:126432548-126432570 AGAGGCAAGAAGTCCCCGCAGGG + Intronic
1076078980 10:127560794-127560816 GGATGCACGGAGTCCCATCGTGG - Intergenic
1077282553 11:1752297-1752319 GGAGGCAAGAAGGCCCAGCTAGG + Intronic
1077300907 11:1846513-1846535 GGAGGCAGGAGGTGCCAGCTGGG - Intergenic
1079117817 11:17651841-17651863 GGAAGCATGCAATCCCAGCTCGG - Intergenic
1083830322 11:65227781-65227803 GCAGGCCAGAAGTGCCAGCTGGG + Intergenic
1084662432 11:70554031-70554053 GGCTGCAGGAAGTCCCCGCTGGG + Intronic
1084725898 11:70941729-70941751 GGAGGCTGGAAGTCCGAGCAAGG - Intronic
1089226335 11:116925533-116925555 GGAGGTCAGAAGTCCAAGCTGGG - Intronic
1091158966 11:133402125-133402147 GGAGGCTGGAAGTCCAAGGTTGG + Intronic
1092533194 12:9362070-9362092 GGAGGCACGAAGTCTCTTCTCGG + Intergenic
1096807045 12:54147222-54147244 GGAGGCAAGAAGTCACAGGCTGG - Intergenic
1102151256 12:110690060-110690082 GGAGGCCAGAAGTCTCAGATGGG + Intronic
1105614482 13:21999870-21999892 GCAGGCCTGAAATCCCAGCTGGG - Intergenic
1107381139 13:39857476-39857498 GGAGGAGCTAAGTCCCAGCACGG + Intergenic
1113772234 13:112917591-112917613 GAAGGCACGAAGGGCCAGGTGGG - Intronic
1121113676 14:91329299-91329321 GGAGACACAAAGTTCCAGGTGGG + Intronic
1121960988 14:98259286-98259308 GGAGCCTCTAAGGCCCAGCTGGG + Intergenic
1126176664 15:45742316-45742338 GGAGGCTGGAAGTCCAAGATCGG - Intergenic
1128478497 15:68017519-68017541 GGTGGCGCCAAGTCCCACCTAGG - Intergenic
1128634665 15:69295453-69295475 GGAGGCCAGAAGTCCCAAGTCGG - Intergenic
1129490110 15:75916345-75916367 GGAGGCTAGAAGTCCAAGATCGG + Intronic
1130024924 15:80262590-80262612 GGAGGCATGAAGCCCTAGATGGG + Intergenic
1132556938 16:576654-576676 CAGGGCAGGAAGTCCCAGCTGGG - Intronic
1132837124 16:1959751-1959773 AGAGGTACGAAGCCCCAGCCCGG + Exonic
1137038925 16:35591861-35591883 TGAGGACCCAAGTCCCAGCTCGG - Intergenic
1138011090 16:53380744-53380766 GGAAGCTGGAAGTACCAGCTAGG - Intergenic
1141767420 16:86067813-86067835 GGAGCCAGGGAGTCCCAGCGGGG + Intergenic
1143021901 17:3921329-3921351 GGAGGCACAAAATCACAGCAGGG - Intergenic
1145299644 17:21623910-21623932 AGAAGGACGAAGGCCCAGCTAGG + Intergenic
1145350639 17:22079357-22079379 AGAAGGACGAAGGCCCAGCTAGG - Intergenic
1145915687 17:28572701-28572723 GAAGGTACCAGGTCCCAGCTGGG + Intronic
1147425154 17:40342672-40342694 GAAGGCAAGAGGTCCGAGCTGGG - Intronic
1150554122 17:66238254-66238276 AGAGGAACGGAGTCCTAGCTAGG + Intronic
1151336378 17:73442242-73442264 GGAGGCTGGAAGTCCCAGATTGG - Intronic
1151686597 17:75650829-75650851 TGATGCCAGAAGTCCCAGCTCGG + Intronic
1152179273 17:78807668-78807690 GGAAGCGAGAAGTCTCAGCTGGG + Intronic
1153815021 18:8784230-8784252 GGGGGCACGCAGCCCCAGGTGGG - Exonic
1156328345 18:36094883-36094905 GAAGGCAGGAAGGCCCAGCTTGG + Intergenic
1157403849 18:47407630-47407652 GGAGGCAGGAGGTCTCTGCTAGG - Intergenic
1160501652 18:79404187-79404209 TGAGGAACGATGTCCCAGGTTGG + Intronic
1160855473 19:1215270-1215292 GGTGGCACCAATTCCCAGCAGGG - Intronic
1163376809 19:16938228-16938250 GGAAGAACGATGTCCCAGCTGGG - Intronic
1163777558 19:19227161-19227183 GGAAGCTCCAAATCCCAGCTGGG + Intronic
1164473663 19:28556101-28556123 GGAGGCAGCAAGGCCCACCTTGG - Intergenic
1167409538 19:49336905-49336927 AGAGGCACGAAGGCCAAGCCTGG - Exonic
1167579169 19:50331908-50331930 GCAGTGACGCAGTCCCAGCTAGG - Intronic
1167828470 19:51997181-51997203 GGTGGCATGTAGTCCCAGCTAGG + Intronic
927911850 2:26905362-26905384 GGAAGCAGGTAGTCCCAGCCTGG - Intronic
928387436 2:30882528-30882550 GGATGAAGGAAGACCCAGCTGGG - Intergenic
930305821 2:49673332-49673354 TGAGGCCAGAAGTCCCAGCCGGG - Intergenic
931217992 2:60264058-60264080 GGTGGCAGGAACTCCCAGCAGGG - Intergenic
933780837 2:85799785-85799807 CAGGGCACGAAGTCACAGCTGGG - Intergenic
935074127 2:99724007-99724029 GGAGGCTGGAAGTCCCAGTCAGG - Intronic
942888403 2:180956961-180956983 GGAGGCTGGAAGTCCAAGATAGG - Intergenic
944721793 2:202430042-202430064 GGAGGCTAGAAGTCCAAGATAGG + Intronic
946287002 2:218711219-218711241 GGAGGCGCGAAGTCCCGGCCGGG - Intronic
948193887 2:236080691-236080713 GGAGGTCAGAAGTCCAAGCTGGG + Intronic
1171293797 20:23998817-23998839 GAAGCCACGTAGTCACAGCTTGG + Intergenic
1172117086 20:32579524-32579546 GGAGGCTGGAAGGCCCATCTGGG - Intronic
1172181367 20:33005705-33005727 GGAGGTCTGAAGTCCCAGATGGG - Intergenic
1174112841 20:48208032-48208054 GGAGGCACCAAGGCCCAGGCAGG + Intergenic
1174377975 20:50138946-50138968 GGGGTGAGGAAGTCCCAGCTGGG - Intronic
1176663785 21:9664562-9664584 GGAGGCACCAAGAGCCAGCCAGG + Intergenic
1176974025 21:15298203-15298225 GGAGAGACAAAGTCTCAGCTGGG + Intergenic
1177001258 21:15615980-15616002 GGAAGCCCGAAGTCTCATCTAGG - Intergenic
1177014797 21:15773145-15773167 GGAGGCTCAAATTCCCAGCTGGG + Intronic
1177714208 21:24817957-24817979 GGAGGCAGGAAGTCCAAGTTTGG - Intergenic
1177996653 21:28108152-28108174 GGAGGCAGGAAGACAGAGCTTGG + Intergenic
1178296543 21:31414988-31415010 GGAGGCAGGAAGTCACAGAAAGG + Intronic
1178897156 21:36568389-36568411 GGAGGCACGAAGTCCCAGCTAGG + Intronic
1179512266 21:41880882-41880904 GGAGGCATGAAGTCGCAGGTGGG - Intergenic
1180013640 21:45068855-45068877 GGAGGCGGGAAGGCCCAGCGAGG - Intergenic
1181462861 22:23095571-23095593 GGAGGCACTCAGTGCCAGCAGGG - Exonic
1184040675 22:41941392-41941414 GGAAGCAGGAGGTCCCAGCCTGG - Intronic
1184117076 22:42428389-42428411 GGAGGCAGGAGGTCTCAGCCGGG + Intronic
950504605 3:13386879-13386901 GGAGGCAGGAGGTCACAGGTCGG - Intronic
953672542 3:44975486-44975508 CGAGGCAAGAGGTCCCAGCAAGG + Intronic
955100824 3:55848078-55848100 TGAGCCACCAAGCCCCAGCTAGG + Intronic
955913450 3:63881947-63881969 GGAAGCAGGAAGTCCCAATTTGG + Intronic
961000908 3:123373424-123373446 GGAGTCTCCAAGTCTCAGCTGGG + Intronic
962282403 3:134061783-134061805 GGAGGCTGGAAGTCCAAGATCGG + Intergenic
962482701 3:135811360-135811382 GGAAGCATGAAATCCCAGATTGG + Intergenic
967896854 3:194402240-194402262 GGAGACACGGAGCCCCTGCTAGG - Intergenic
968075424 3:195813484-195813506 GCAGACACCAAGGCCCAGCTTGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969318565 4:6396504-6396526 GGAGACACCAACTCCCAGCCTGG + Intronic
969491930 4:7504393-7504415 AGAGACACGAAGTCCCTGCTGGG + Intronic
969690524 4:8701673-8701695 GGAGGCAAGAAGTCTCTCCTGGG + Intergenic
971885734 4:32445134-32445156 GGAGGTAAGAAGTGCCTGCTAGG + Intergenic
975297614 4:72751846-72751868 GGAAGCTCGAGGCCCCAGCTGGG - Intergenic
978439615 4:108719598-108719620 GGAGGCTGGAAGTCCAAGATTGG - Intergenic
984934005 4:184874155-184874177 GGAGGAAGGATGGCCCAGCTGGG - Intergenic
985409241 4:189665248-189665270 GGAGGCACCAAGAGCCAGCGAGG + Intergenic
985911533 5:2887643-2887665 GCAGACACCAAGTCCCACCTTGG - Intergenic
986196180 5:5537997-5538019 GGAGGCAAGAAGCCCCTCCTTGG - Intergenic
994620259 5:102154793-102154815 GGAGGCACCAAGAGCCAGCGAGG - Intergenic
995462729 5:112419942-112419964 GGAGGAGCGACGCCCCAGCTGGG + Intergenic
996858049 5:128031868-128031890 GGATGCCTGTAGTCCCAGCTAGG + Intergenic
997997347 5:138597299-138597321 GGAGGCTAGAAGTCCAAGATGGG - Intergenic
998002968 5:138639328-138639350 GGAAGCAAGAAGTGCCAACTGGG + Intronic
998250744 5:140550565-140550587 TGAGGGAAGAAGTCCCACCTGGG - Exonic
999430889 5:151524512-151524534 GGAGGCTGGAAGTCCCAGATCGG - Intronic
1001000333 5:167999932-167999954 GGAGGCACGAAGTCCTGGGCTGG - Intronic
1003271102 6:4608752-4608774 GGAGGCACGATGACCAGGCTGGG + Intergenic
1004479113 6:16001974-16001996 GGAGGCAGGAAGGCCCTGCAGGG - Intergenic
1004486613 6:16072432-16072454 GGAGGCTGGAAGTCCGAGATTGG + Intergenic
1004899152 6:20178201-20178223 GGAGACACGAAGTTGCATCTTGG - Intronic
1005492785 6:26361941-26361963 GGAGGCCTGAAGACCCAGCTGGG + Intergenic
1005496950 6:26396062-26396084 GGAGGCCTGAAGACCCAGCTGGG + Intergenic
1005501720 6:26434538-26434560 GGAAGCCTGAAGACCCAGCTGGG + Intergenic
1013625910 6:111936761-111936783 GGAGGCAGGCAGAGCCAGCTGGG + Intergenic
1015075240 6:129148725-129148747 GAAAGCAGGAAGGCCCAGCTGGG - Intronic
1015575866 6:134670424-134670446 GGAGGCTAGAAGTCCAAGCAAGG - Intergenic
1017051699 6:150399688-150399710 GGAGGCTGGAAGTCCAAGGTCGG + Exonic
1017490724 6:154942677-154942699 GGGGGCACGAAGACCCAGAGAGG - Intronic
1017929182 6:158937844-158937866 GTAGGCCTGTAGTCCCAGCTAGG + Intergenic
1018252781 6:161888840-161888862 GGAAGCATGAAGTCTAAGCTGGG - Intronic
1019487992 7:1298258-1298280 GGAGGCAGGCAGTGCCAGCCGGG - Intergenic
1020214690 7:6180564-6180586 GGAGGCCAGAAGTCCGAGATCGG - Intronic
1024197639 7:47074781-47074803 GGAGTCACCAAGGCCCAGCGTGG + Intergenic
1029192790 7:98783628-98783650 GGAGGCAAGAATTCCCAGACTGG + Intergenic
1038040748 8:23722378-23722400 CAAGGCACTAAGGCCCAGCTGGG - Intergenic
1039374912 8:37023645-37023667 AGAGGCAGGAAATCCCAGATAGG - Intergenic
1047232417 8:123008797-123008819 AGAGGCACCAGGTCCAAGCTGGG + Intergenic
1050177619 9:2884374-2884396 GAAGATACGAAGCCCCAGCTGGG - Intergenic
1050647977 9:7742588-7742610 GGAGGCAGGAAGTGCAAGGTGGG + Intergenic
1052776773 9:32740483-32740505 GGAAGCAGGAAGTCCCTGCCTGG - Intergenic
1056124922 9:83526576-83526598 GGAGGCACCAAGTGCAGGCTGGG - Intronic
1056677315 9:88686421-88686443 GGAGGCACCAAGAGCCAGCGAGG + Intergenic
1060298321 9:122358114-122358136 GGTGGCATGAAGTTCCAGCAAGG + Intergenic
1060594589 9:124840552-124840574 GGCGGCACGAGGCCCCAGCCAGG + Intergenic
1061373645 9:130211870-130211892 GGTGCCACCAAGGCCCAGCTGGG + Intronic
1061430562 9:130527807-130527829 AAAGGCAGGAAGTCCCACCTTGG - Intergenic
1061624147 9:131831374-131831396 GGAGGCCAGAGGACCCAGCTCGG + Intergenic
1061943349 9:133894576-133894598 GGAGGCATGAGGGCCCAGCAGGG + Intronic
1062195464 9:135271115-135271137 GGAGGGAGGGGGTCCCAGCTGGG + Intergenic
1062506874 9:136882100-136882122 GGAGGCAGAATGTCCAAGCTGGG - Intronic
1062531347 9:137002033-137002055 GGAGGCTCGAAGTCCGAGGTCGG - Intergenic
1203662314 Un_KI270753v1:57200-57222 GGAGGCACCAAGAGCCAGCCAGG - Intergenic
1185869982 X:3656856-3656878 GGAGGCTGGAAGTCCGAGGTCGG + Intronic
1187608583 X:20914960-20914982 GGGGGTAGGAAGTCCCAGATTGG - Intergenic
1188242487 X:27808991-27809013 GGAGGCACCAAGAGCCAGCGAGG - Intronic
1189489908 X:41462548-41462570 GGAGGCTGGAAGTCCAAGATTGG + Intronic
1192718607 X:73669017-73669039 GGTGGCCAGAAGTTCCAGCTGGG + Intronic
1194953441 X:100153264-100153286 GGTGGCCGGAAGCCCCAGCTGGG + Intergenic
1197316845 X:124977071-124977093 GGAGTCAGGAAGTCTGAGCTTGG + Intergenic
1197931853 X:131704491-131704513 GAAGGCAAGAAGACCTAGCTTGG - Intergenic
1199979972 X:152915460-152915482 GGAGCCACGGAGGCCCAGCAGGG - Intronic